Agent: Escherichia coli as per urine test a. Nutritive  b. chemical C, Physical D. Infectious agent E. mechanical f. Psychosocia;

Q: Hemocytes are stem cells which become red blood cells (RBC). The RBC's are filled with a protein…

A: Red blood cells (also known as erythrocytes) are the most common type of blood cell and are an…

Q: Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that are…

A: Gene expression involves two processes that is- transcription and translation. Transcription is a…

Q: The chromatophore pigment is present in which animal group? Annelida Nematoda Cephalopods O…

A: Chromatophores are the cells which can produce color. Many types of pigment containing cells or…

Q: Below is a table of allele frequencies. Locus 1 Freq(116) = 0.3 Freq(120) = 0.4 Freq(124) = 0.3…

A: Gene frequency is the proportion of a specific gene or allele that is repeated over time in a given…

Q: 2. Using a reference, find the function of smooth muscle tissue in humans and one would find it.…

A: The hollow body organs like the bladder, colon, and stomach all contain smooth muscles. They are…

Q: Describe the diseases Strep Throat and Scarlet Fever in terms of the cause(s), the sign/symptoms,…

A: *Strep throat is caused by bacterial infection which can cause inflammation and pain in throat. This…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Briefly explain how you can determine the presence of coliform bacteria in a water sample.

A: Coliforms are a type of bacteria. These organisms are normally harmless to the species or hosts they…

Q: If I set up a Chi square analysis and determine that I cannot reject the null hypothesis based on my…

A: When the sample sizes are large, a chi-squared test is a statistical hypothesis test used in the…

Q: Can we just insert a gene on an organism? - In plants, the use of Agrobacterium, we're there any…

A: Transfer of genes is a common component of genetic engineering projects, i. e. DNA transfer between…

Q: Describe the development of internal and external sexual in individuals who inherit XX sex…

A: SRY stands for sex determining region Y protein. It is present on Y chromosomes without introns. It…

Q: B. Next you isolate DNA from colonies and cut the DNA with the restriction enzymes you chose from…

A: A. As the plasmid contains ampicillin resistance gene, therefore, it confers resistance to amicillin…

Q: A total of 2.5 x 105 cells were harvested from the patient. You need the cells to fill a scaffold…

A: The growth or culturing of cells obtained from different sources such as humans, animals, or plants…

Q: Some Traits in Garden Pea Plants In pea plants, the genes for seed shape, seed colour, and plant…

A: The method GREGOR MENDEL described as a cross to identify the hidden characters is known as a…

Q: minimum edit distance

A: The minimum edit distance between two strings is defined as the minimum number. of editing…

Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…

A: Introduction: The crossmatch test is a crucial component of the living donor evaluation and is…

Q: Assume two alleles A1 and A2 with known frequencies e.g. p (A1) = 0.7, q (A2)= 0.3 What would be…

A: There is single gene. It has two alleles: A1 and A2. The allelic frequency of A1: 0.7  The allelic…

Q: Identical (monozygotic) twins have identical genomes. In one pair of identical twins, they inherit a…

A: Types of twins. 1. Monozygotic (identical) Twins: These twins are formed when a single fertilized…

Q: Match the following events with the stages in Meiosis Prophase I…

A: These are the stages of meiosis first division which is associated with reproductive cells. The egg…

Q: 3. Now consider the following diagram, where two replication bubbles are about to meet. 5 3 Draw in…

A: The lagging strand is the one that starts to open in the 3' to 5' direction toward the replication…

Q: which is the following is not a step in the process of de novo gene birth? o translated peptides…

A: The method through which new genes arise from DNA sequences which weren't previously genic is known…

Q: Structural differences between a B cell and a plasma cell in relation to their function?

A: Immune cells are an important part of our body that helps to protect us by developing immunity. B…

Q: Q2 (a) In 2014, during their iGEM project on biodesalination, students were willing to modify…

A: There are perform a restriction digestion process by restriction endonuclease PstI which recognize…

Q: Can nanomaterials in smart packaging be used to monitor food fermentation?  subject:

A: Nanomaterials can be used as a food additive or nutritional carrier in food packaging, as well as a…

Q: The difference(s) between epithelial and single cells is that epithelia: O A. Allow absorption or…

A: Enzymes, hormones, and fluids can be secreted (released) by glandular epithelial tissue. Internal…

Q: I am more so wondering about the structural differences between the two cells, like the organelle…

A: Lymphocytes plays an important role in determining the immunity of an individual. It can be divided…

Q: Define what is meant by the term Group A Strep (GAS). What are three properties that you could…

A: Group A strep is also called as group A streptococcus. These are the bacteria which can be found in…

Q: What are the risks and protocols for testing growth of bacteria

A: Please follow steps 2 & 3 for detailed explanation.

Q: Explain how partial pressure differences influence the movement of O₂ and CO₂ between the alveoli…

A: Little air sacs called alveoli have a balloon-like form. The alveoli and blood capillary exchange…

Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?

A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…

Q: Use the following information to answer the next question. A bacterium has been found that…

A: According to Bartleby guidelines a single question or in the case of question having subparts,…

Q: Which of the following features is NOT a characteristic of ALL animals? Self-propelled movement…

A: Introduction:- Living Organisms are classified into various groups on the basis of presence or…

Q: Use the following information to answer the next question. A Venn Diagram Showing the Relationship…

A: All the hereditary information is passed from one generation to another via genetic combinations.…

Q: ad this story and identify the different aspects of the scientific method by choosing the Cement…

A: In order to prove something scientifically one conducts experiment on the basis of the observations.…

Q: Why do we study primates? Why is it important to study human evolution?

A: The study of anthropology is a broad one and covers a variety of topics. In its most basic form,…

Q: Agrobacterium tumefaciens is ...   Question 61 options:   a family of transposable elements found…

A: Genetic engineering is a process in which genetic makeup of an organism altered by introduction of…

Q: what hypothesis regarding diversity and ecosystem function has the most support

A: An ecosystem is a community of living organisms in conjunction with the nonliving components of…

Q: Outline the general process of transcription (dna->rna) include a diagram a) include the basic…

A: Transcription is the process of synthesis of RNA from DNA. It involves three steps, initiation,…

Q: 3. In the case of Ashley-X, which of the following was requested from the parents so they could take…

A: Ashley X is an American child with several developmental disabilities because of the static…

Q: The human body has structures that could be considered the product of “unintelligent design” (i.e.…

A: Organisms are never perfectly designed or adapted. In reality, "perfection" cannot be found in…

Q: Discuss the structure of a neuron and the function of nervous tissue. (KEEP IT SHORT PLEASE

A: Neurons are building blocks of nervous system. They receive and transmit signals to different parts…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Based on the change to the nucleóti How did this mutation change the amino acid sequence of the…

A: A mutation is the term that describes change seen in the sequence of nucleotides that may…

Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…

A: This activity is about different types of living beings which have different characteristics such as…

Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…

A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…

Q: 2.- Draw a step by step diagram of the translation process then explain what is happening in each…

A:

Q: hich of the following is true regarding the way we define clades with characters? Select one: a.…

A: A phylogenetic tree is a diagram used to visualize evolutionary relationships between organisms. It…

Q: Based on the haplotype network below, which statement is correct? a. None of the answers is correct…

A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…

Q: What materials used for bioprosthesis heart valves (the chemically pretreated heart valves)?

A: Prosthetic valves are used to replace diseased or non-functional or dysfunctional heart valves. It…

Q: Use the Chain of Infection to describe Legionnaire’s disease

A: Introduction Legionnaire’s disease it is type of pneumonia caused by legionella bacteria. lung…