Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryo

Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryo

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter17: Developmental Genetics

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

Maternal and zygotic mRNAs regulate embryonic development by determining major body axes. Two of the these mRNAs code for the proteins ____ (of maternal origin) and (of zygotic origin), which are morphogens that accumulate at the end of the egg that will become the anterior end of the embryo, whereas two other mRNAs code for the morphogens ____ (maternal origin) and ____ (zygotic origin), which accumulate at the opposite end of the egg and determine the posterior end of the embryo. The dorso-ventral axis of the embryo is established by two morphogens coded for by maternal mRNAs: (1) ____, which is transcribed in the egg nucleus and accumulates in a crescent on the side of the egg that will become the dorsal surface; and (2) ____, which is transported after fertilization into blastodermal cells that will become the ventral surface, and in these cells activates the zygotic gene ____, which produces a protein that diffuses to the blatodermal cells at the opposite side of the egg and…
At the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence would be altered.
In the sea urchin, early development may occur even in the presence of actinomycin D, which inhibits RNA synthesis. However, if actinomycin D is present early in development but is removed a few hours later, all development stops. In fact, if actinomycin D is present only between the sixth and eleventh hours of development, events that normally occur at the fifteenth hour are arrested. What conclusions can be drawn concerning the role of gene transcription between hours 6 and 15?
Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene in yeast is always producing mRNA, but the Gcn4 protein is only made when the cells are starved. B. What does this mean for diagnostic techniques that try to look at gene expression?
When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What are the controls you should use and why use these? What is special about the genomic DNA? What do you expect to find (using these genomic DNA samples)? please help!
Which of the following statements about Tbx5 is true? a. Tbx5, Tbx4, and AmphiTbx4/5 have very similar coding regions. b. Tbx5 is involved in tail development in vertebrates. c. Tbx5, Tbx4, and AmphiTbx4/5 have very similar regulatory regions. d. Tbx5 initiates hindlimb development.
What is the purpose of syncytin, the protein product of sequences originally added to the human genome from a retrovirus, as it relates to early fetal development in human reproduction?
given a situation in which you manipulated a zebrafish embryo by injecting high levels of retinoic acid so that no anterior genes will be expressed. Surprisingly, after embryonic development, you are still able to observed the presence of anterior structures. What could explain this observation? What changes in your experiment would you make to achieve your objective?
In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed . Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an eggcell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095–1098). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
In flies, the gap gene kruppel is expressed in a broad band in the middle of the embryo with giant expressed as its anterior border and knirps at its posterior border. How is the expression of kruppel limited to this band in the embryo? Describe the spatial regulation of the kruppel gene.
How have we discovered that specific genes control development in an organism like Drosophila?