B5. When a tapeworm obtains nutrition from the human intestine, but causes harm to the human host in the process (due to human loss of some nutrients), this type of symbiosis represents: A. a form of amensalism B. a form of mutualism C. a form of parasitism D. a form of neutralism E o fornm of comnetition

Q: What is the other pathway of antigen processing? What is the advantage of having two distinct…

A: Antigen processing, also known as the cytosolic pathway, is an immune mechanism which prepares…

Q: Which domain of the DNA polymerase has a role on correcting the position of the primer and the…

A: Introduction A domain is a specific physical region or amino acid sequence in a protein that is…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Analyze the pair of words given. Choose the best letter of another pair with the same relationship.…

A: *Mus musculus is house mouse belongs to order Rodentia having a pointed snout and  large rounded…

Q: 4. In the concept map of the endocrine system below fill out the names of endocrine glands…

A: Together, insulin and glucagon help maintain a state called homeostasis in which conditions inside…

Q: What evidence led Emil von Behring to discover antibodies and the complement system in 1905?

A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…

Q: The fossil record (a) usually occurs in sedimentary rock (b) sometimes appears fragmentary (c) is…

A: All life on Earth descended from the universal last common ancestor, who lived between 3 and 4…

Q: Why is mutation important to evolution if it is the microevolutionary force t

A: Mutation is the process in which the DNA sequences are changed due to misplaced entries, deletion or…

Q: How do studies of brain development in knockout mice support the statement that apoptosis is a…

A: Apotopsis is a process of programmed cell death. It is a process in which the cell division is…

Q: Worthiness of development 5= very worthy, 1= not worthy at all 5 4 3 2 1 Aspects Reasons Agriculture…

A: Genetic engineering, often known as genetic modifications, is the use of molecular techniques to…

Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?

A: *oxygen is an important gases for human body each cell in human body requires amount to oxygen for…

Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…

A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…

Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…

A: The "nervous system", also known as the neural system, is a complicated network of neurons that are…

Q: Provide names of two molecular chaperons and their functions for MHC I antigen presentation pathway

A: MHC class I molecules are comprised of a polymorphic transmembrane heavy chain and a soluble protein…

Q: Define about dideoxynucleotides (abbreviated ddNTPs) ?

A: The genome of an organism is defined as the entire genetic information that is passed down from…

Q: Sketch a diagram to illustrate the interaction between MHC I molecules of the named cell type and…

A: The MHC I molecules are the major histocompatibility complex I which are present on the surface of…

Q: If you discover new bacteria from the sands of Culebra's beaches that have the ability to degrade…

A: Although biochemical techniques have only identified a small number of plastid proteases,…

Q: 11. Based on the number of differences in amino acid sequence, which pair of organisms are least…

A: Option A i.e Human - Kangaroo

Q: Describe briefly the generation of the active form of the transcription factor NFAT. Include the…

A: Nuclear factor of activated T cells (NFAT) was first identified as a Ca 2+/calcineurin-regulated…

Q: Parent Cross: Blue-Eyed Male x Normal Female Blue-Eyed Female F1 Offspring Normal Male Normal Female…

A: Drosophila melanogaster. The position of the white eye gene, positioned at the x-chromosome of this…

Q: What is Binomial system of nomenclature? Who proposed this system? Why is binomial nomenclature the…

A: Binomial Nomenclature Carolus Linnaeus in the 1750s gave the formal naming system to organisms…

Q: Monarch butterflies are a foul-tasting, poisonous species of butterfly. Monarchs feed almost…

A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…

Q: Complement can enhance phadocytosis because of the presence on macrophages and neutrophils of…

A: The correct option is C3b.

Q: Here you see the gel electrophoresis of PCR reactions of the pMCT118 VNTR locus of 4 individuals…

A: Answer pMCT118 VNTR  locus has multiple repeats that can be analyzed by Polymerase chain reaction…

Q: Type of Dermal Scale Cosmoid Placoid Shark Tooth Ganoid Cycloid Ctenoid Mammalian Tooth To compare…

A: Introduction  cosmoid scales have hard enamel, inner layer of cosmine , and vascular bone layer.…

Q: If there is a certain trait that you want animals or humans to possess, what is it? To what organism…

A: The desired trait can be anything in regards to the desired charecteristic to be reflected in human…

Q: Consider a person without any functioning plasma cells. What effects would this condition have on…

A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…

Q: 4. You are looking at a series of rock layers and you want to survey the youngest stratum. How will…

A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna…

Q: Telomerase contains DNTP molecules as a template for DNA synthesis O True O false

A: DNA( Deoxyribonucleic acid ) is two strand helical structure which serves as genetic material vin…

Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…

A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…

Q: Describe the cerebrum, cerebellum, and spinal cord's white and gray matter areas. Include the…

A: Cerebrum is the largest part of our brain, it is a part of forebrain. It is related to the…

Q: Describe the nature and extent of genetic variation, including genetic polymorphism, balanced…

A: There are basically three types of genetic variation. These are:   Single base-pair substitution –…

Q: Dicuss a campain for Diabetes in the UK.

A: Campaigns are the way to convey the message or awareness to the people for achieving specific…

Q: Question 8 Why does each cell need DNA? O DNA is used by cells for cell transport DNA determines the…

A: Introduction DNA contains the instructions needed for an organism to develop, survive and reproduce,…

Q: nucleotides - adenine, guanine, cytosine, and thymine?

A: 1.  DNA is made up of long chain polymer of polynucleotide. A nucleotide consist of nitrogenous…

Q: what are the advantage and disadvantages of planting native trees in an urban area

A:

Q: Meiotic double strand breaks are repaired by SPO11. * True false

A: Meiotic recombination is the process of reciprocal exchange of genetic material (DNA) between the…

Q: 1. You want to jump on the home-based food business bandwagon that sprang up during the pandemic.…

A: Fermentation   Fermentation is a biological metabolic process that convert glucose or sugar into…

Q: What is the role of dynamin in recycling synaptic vesicles? What evidence supports this?

A: GTP bonding protein, also referred to as G protein. G protein is found in eukaryotic cells and is…

Q: In chapter 8 we read that in tumor cells Rb protein is hyperphosphorylated. In response to that,…

A: p53 suppresses the cell proliferation mediated by the Rb-E2F pathway. Phosphorylation of Rb by…

Q: Anatomical structures that share a common ancestry are called __________structures. *

A: This question is based on homologous and analogues structure.

Q: Knockout mice are mice in which certain genes are rendered irreversibly nonfunctional through the…

A: The knockout mouse has been a valuable tool for geneticists to discern the role of a gene in…

Q: My Diagnosis for Pati Sex: Chromosomal Disorder Justification:

A: Chromosomes are the parts of your cells that contain your genes. Genes are parts of DNA passed down…

Q: What did genera discussed the Staphylococcus? Are the healthcare concerns, infections, and…

A: the genus is divided into the two species Staphylococcus aureus and S. albus. Zopf (1885) placed the…

Q: 1. Look again at the six embryos in their earliest stages. Describe the patterns you see. What…

A: Species and their anatomical changes from early stage to late stage. Human : well developed limbs ,…

Q: Explain "Numerical taxonomy" briefly.

A: Introduction In this question we will explain the Numerical taxonomy.

Q: How SBS methods are useful for human genomes ?

A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…

Q: What is the role of glial cells in the brain and other parts of the nervous system?

A: Introduction :- Glial cells, also known as neuroglia, are cells that surround and support the…

Q: Proof-reading during DNA replication refers to: * O removal of thymine dimers by by excision repair…

A: DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA…

Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…

A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…

Parasitic infections

A parasite is an organism that lives in the body of another organism and obtains food at the expense of the host. There are two kinds of parasites they are internal and external. An internal parasite lives inside another organism and is known as endoparasite. An external parasite lives on the body surface of the host and is known as an ectoparasite.