Q: Discussion on the physiology of kidney which causes or lead to disease such as Chronic Renal Failure…
A: introduction : A persistent impairment of kidney function, also known as chronic renal failure (CRF)…
Q: If the progeny of the cross aaBB x AAbb is testcrossed, and the following genotypes are observed…
A: Given information Progeny of the cross aaBB x AAbb is testcrossed. The genotypes observed from the…
Q: Why does the elution buffer bot contain sodium?
A: Buffer can be defined as a solution,which does not allow changes in the pH of solution,even when…
Q: List and explain the assumptions and uses of the Hardy-Weinberg Principle. Provide examples (and…
A: HWE The principle state that if forces of evolution is absent then the frequency of genotype of…
Q: Would you expect water molecules to move faster when there is a HIGH concentration gradient or a LOW…
A: The movement of molecules across the plasma membrane of the cell depends on their concentration…
Q: These data were collected experiments on laboratory populations. Experiments such as these where we…
A: Introduction The search for truth is the basis of every research and experiment. It is studied under…
Q: A string of 8 uracil nucleotides in the mRNA is required for function of an intrinsic transcription…
A: DNA transmits information to proteins in a continuous flow. DNA controls this basic central dogma…
Q: Assume a case of disputed paternity involving two men (A and B) and four children (W,X, Y, Z). On…
A: Given information 2 men and 4 children are tested for paternal dispute. Reactions in antisera…
Q: Abnormal mitosis vs Normal mitosis
A: The process of creating two or more daughter cells from a parent cell is known as cell division.…
Q: What is the TMJ? What is unusual about this joint and why is it important?
A: Introduction: When two bones come into contact, it forms a joint. Joints can be categorised…
Q: A 67-year-old retired male went to his doctor, complaining initially of leg pain that started in his…
A: Introduction Hormones are a group of signalling molecules found in multicellular organisms that are…
Q: Compare and contrast cut & paste and replicative transposition.
A: Compare and contrast cut & paste and replicative transposition.
Q: If you have an mRNA sequnece below that looks like : 5' cap, Cytidine, CCUCUUUUCC, gene, AAAAA…
A: Messenger RNA or mRNA is a single stranded RNA synthesized from a DNA template by a process called…
Q: XL 10 Gold cells and Express I^q cells. Give three differences between their genotypes and how each…
A: The XL10-Gold ultracompetent cells were designed for cloning large plasmids and ligated DNA with the…
Q: Given the following, the sequence of urine flow in the urinary tract is: i. Renal papilla ii. Major…
A: We know that Urine is formed by filtering the blood in the kidney in the body. Metabolic wastes such…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: Voltage, Currents, Conductances What do the graphs of voltage, Na* current, K* current, Na*…
A: A nerve impulse is the electric signals that pass along the dendrites to generate a nerve impulse or…
Q: Which Scyphozoan life stage performs sexual reproduction? Gemmule Planula Scyphystoma Medusa Ephyra
A: The members of Class Scyphozoan are marine and mainly consist of jelly fishes.The life cycle of…
Q: Where are the nuchal lines located? What is their function?
A: The nuchal lines of the occipital bone are where many muscles and ligaments of the neck and back…
Q: You want to product human immunoglobulin G using a recombinant Escherichia coli system. Design the…
A: Recombinant tecnology The technology based on making hybrid DNA. In this technology, gene of…
Q: Describe 2 factors that contribute to the efficiency of gas exchange in fish gills. Why are fish…
A: Respiration The process of breathing in oxygen and breathing out carbon dioxide is known as…
Q: Define what is a scientific theory and describe what makes up one.
A: A scientific theory is a well-organized explanation that frequently includes a scientific hypothesis…
Q: When a cell takes in a large amount of soluble molecules from the outside, it is called exocytosis…
A: Membrane transport mechanism is a type of mechanism that helps in transfer of molecules across the…
Q: What are the three cons of deciduousness?
A: The word deciduous in biology describes a tree, shrub, or other plant which totally loses its…
Q: Continue to assume that the same four individuals in the pedigree are albinos, and calculate the…
A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…
A: Nucleic acids are one of 4 biomolecules. Two types of Nucleic Acids are there which are DNA and RNA…
Q: The ΔG°’ for the aldolase reaction of glycolysis in muscle is +22.8 kJ/mol. Why does the aldolase…
A: Glyceraldehyde-3-phosphate and dihydroxyacetone phosphate are the products that are generated as a…
Q: Provide a summarizing paragraph of the process of translation (no more than 6 lines)
A: Translation is a process by which our cells synthesize proteins. And it's the part of central dogma…
Q: Voltage-gated Na+ channels are.... (select all that apply). Group of answer choices: A. Opened by…
A: The channels are basically membrane proteins that act as transport protein through which various…
Q: The following contains a lesser concentration of particles in comparison to another body of fluid: O…
A: Introduction When more water is being lost from the body than is being taken in, dehydration…
Q: Compare/contrast clathrin, COPI and COPII proteins. "I ... Cul JCC
A: COP 1, COP II and clathrin helps in transport mechanism. COPI, COP II and clathrin are proteins.
Q: Muller's rachet turns faster in......…... species with small genomes populations exposed to mutagens…
A: Introduction and answer= The theory of Muller' Ratchet predicts that small asexual populations are…
Q: Could the mini-prep protocol purify RNA? Why or Why not? Based in your answer, what is the…
A: RNA Miniprep protocol is the RNA isolation protocol which is available and designed for easy,…
Q: Use the concept of sensory adaptation to explain how sensory adaptation occurs for either the sense…
A: INTRODUCTION : Sensory adaptation - It is a reduction in sensitivity/reaction to a stimulus after…
Q: In receptor-mediated endocytosis, each of the following could be a fate for the receptors and/or…
A: Introduction Endocytosis is a cellular mechanism that allows substances to enter the cell. A layer…
Q: Student Y is working with his microbiology experiment, the directions of the agar is to suspend 25g…
A: In microbiology experiment, we generally use 15-20ml media for each petri dish. Here we can consider…
Q: State at least four functions of the kidneys other than forming urine.
A: Introduction :- They are primarily responsible for removing toxins from the blood and turning waste…
Q: ) Explain homology, list and explain the different types of homologies (also give examples)and why…
A: In some species there are similar features or structurs between them which indicates they shared a…
Q: the main function of photosynthesis is the A. production of 02. B. conversion of light energy to…
A: The photosynthesis takes place in the chlorophyll containing cells. It takes place in the…
Q: D What is NOT true about mitosis A B C D mitosis is the means of tissue growth, maintenance and…
A: Cell division involves production of two or more than two daughter cells from a single mother cell.…
Q: 2 Paul and his friends ate at a fast-food restaurant. Paul, who has a mass of 70 kg, had a…
A: It is required by all the organisms to eat food in order to grow and obtain energy to sustain the…
Q: The following image is of a freshwater Hydra sp. (Hydrozoa). Select ALL correct statements below. A…
A: Animal kingdom comprises of all eukaryotic organisms . It is classified into:- (I ) Porifera…
Q: A flower that possesses a single pistil, 1 stamen, no petals, and no sepals: (choose all that apply)…
A:
Q: What is/are true statements about Action Potentials? Select all that apply. Group of answer…
A: Action potential is a rapid rise and fall in voltage or membrane potential across cell membrane.…
Q: How will the cell shift its metabolic processes in response to the level of pyruvate and in order to…
A: Aerobic respiration is a chemical process in which oxygen will be used to make energy from sugars.…
Q: Describe the historical pattern of growth the worldwide human population Since our OF origin
A: Population refers to the number of individuals living in a particular area. Any increase in the size…
Q: What does a “reducing sugar” mean? Which of the following tests is/are specific to reducing sugars?
A: A carbohydrate is a compound made up of carbon, hydrogen, and oxygen atoms. The hydrogen-oxygen atom…
Q: In your own words, explain why DNA binds to the silica column
A: Introduction: Using molecular dynamics simulations, the DNA-silica binding mechanism is as. This…
Q: During neuronal signaling, a change in membrane potential will cause sodium channels to open and let…
A: The sodium potassium pump, also known as the Na+/K+ pump or Na+/K+ ATPase, is a protein pump found…
Q: Each spinal nerve branches into a ventral and dorsal: ganglion root tract plexus ramus
A: Introduction According to the classical doctrine of the nervous system, an animal's nervous system…
Step by step
Solved in 2 steps
- Match the following microorganisms with the descriptionthat best applies:Algae (a) Multicellular nucleated microorgan-Bacteria isms that have branching filamentsFungi (b) Acellular entities that require aProtozoa host for multiplicationViruses (c) Photosynthetic large cells thatHelminthes rarely cause human disease(d) Parasitic worms(e) Large, single-celled nucleated mi-croorganisms(f) Single-celled non-nucleated micro-organismsLactobacillus acidophilus ferments glycogen produced by the vaginal epithelium forming ________ ________ resulting in a pH of 4.4 to 4.6 of the vagina and cervix, thus, inhibiting other microorganisms.Organism - Enterobacter aerogenes 1. 1. Every organism is unique! Provide some interesting facts or details you find fascinating about your organism. Some ideas are historical information, disease outbreaks, useful applications, or personal encounters with the organism. The answer must be unique not from the google please thank you !
- Chopped garlic often contains C. botulinum endospores and iscommonly sold submerged in olive oil, which creates an anaerobicenvironment. What is required to be added to garlic sold in thismanner?a. sodium chlorideb. citric acidc. waterd. A warning label describing the symptoms of botulism.Help indetifying the unknown bacteria ? Gram Stain: Purple Cell Morpholgy: Rods Oxygen Requirement: OA Acid Fast Stain: pink Endospore Stain: pink rods Blood agar-hemolysis: no lysis Phenol red-glucose fermentation:red,no gas Phenol red -lactose fermentation:red,no gas Phenol red - mannitol fermentation:red,no gas Phenol red-sucrose fermentation: red,no gas Methyl red:no change Voges-Proskaur: no change Oxidase: no change Catalase: bubbles Nitrate Reduction: red after a & bHelp indetifying the unknown bacteria ? Gram Stain: Pink Cell Morpholgy: Bacillus Oxygen Requirement: OA Acid Fast Stain: green Endospore Stain: pink rods Blood agar-hemolysis: lysis (yellow clearing) Phenol red-glucose fermentation:red,no gas Phenol red -lactose fermentation:red,no gas Phenol red - mannitol fermentation:red,no gas Phenol red-sucrose fermentation: red,no gas Methyl red:no change Voges-Proskaur: no change Oxidase: purple Catalase: bubbles Nitrate Reduction: red after zinx
- Cytochrome C oxidase Oxidase test results: (color and +/- negative): __________________________________ Organism does or does not possess Cyt C in ETS: _________________________ Is the 0rganism aerobic or anaerobic: _________________________________1.What the optimal pH range for Lactobacillus plantarum? Is plantarum an acidophile, neutraphile, or alkalophile? 2. LAB produce organic acids that have shown to be effective against controlling the growth of foodborne pathogens. What specific organic acid is produced by LAB during fermentation? 3.What is the optimal temperature range for Listeria monocyogenes? Is monocyogenes a psychrophile, psychrophile, mesophile, or thermophile?Saxotoxin identify the species which releases the toxin (if it is man-made then this will be all that is required for this part) identify the step disrupted in the neuromuscular junction pathway Provide any consequences of this disruption. Does the toxin have any applications in biomedicine as a painkiller, disease treatment or analgesic? Provide your source in APA format for each. If this is missing no credit will be awarded.
- Archae are the source of many enzymes used for biocatalysis in diverse industries such as food and feed, pharmaceuticals, detergent, and beverage industries. These enzymes have unique structural and functional properties that enable use under extreme conditions. Use: https://biolres.biomedcentral.com/articles/10.1186/s40659-018-0186-3 for supplemental info What are three classes of extremophiles and their unique growth characteristics? Based on these characteristics, where are they typically found? The functional properties are linked to protein structural characteristics that imparts unique functional properties. For alkaliphiles and thermophiles, what structural elements (or characteristics) within the enzyme structure create these unique properties? See Table 2. Briefly discuss how the unique properties of these enzymes may be beneficial to the design of bioseparation processes. To recover intracellular enzymes, the Archae need to be lysed. Based on their structures,…This is the 6 step scientific method told in class but I don’t understand that well please explain it to me1observation 2question 3hypothesis 4test 5experiment 6conclusionMulticellular organisms with a true nucleus, ester-linked fatty acids in their G-3-P cell membranes, histone proteins, and cell walls with a high cellulose content (above 20%), but no collagen, must be: members of kingdom Archaeobacteria members of kingdom Eubacteria members of kingdom Animalia members of kingdom Plantae members of kingdom Fungi
