Q8.A. Use Punnett square method to show the inheritance of deafness (d) which is inherited as a recessive trait. Analyze the result. B. Refer to the figure below. Compute the percent (%) diversity of vertebrates and invertebrates. Show the solution. Round off % value to the nearest whole number.

Q8.A. Use Punnett square method to show the inheritance of deafness (d) which is inherited as a recessive trait. Analyze the result. B. Refer to the figure below. Compute the percent (%) diversity of vertebrates and invertebrates. Show the solution. Round off % value to the nearest whole number.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter55: Biodiversity And Conservation Biology

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Related questions

Q: You've been out in the field collecting data on the predation of holly leaves. You collect 200…

A: Leaf miners are the larva stage of insects that resides on leaves for shelter and food. Leaf mining…

Q: Are drugs that target cell wall synthesis effective for all bacteria?

A: Introduction Drugs are chemical substances that are used to prevent the growth of pathogens.…

Q: How would an aerobic growth curve change with; a higher Temp a lower Temp an addition of 8% salt

A: This pattern can be graphically represented as the number of living cells in a population over…

Q: What is the name of the structure that the microtubules bind to during mitosis?

A: Introduction During the mitotic phase, a cell duplicates its chromosomes, segregates them, and…

Q: A team of botanists discovers a new species of plant in a tropical rain forest. After observing its…

A: Any eukaryotic organism that is not an animal, plant, or fungus is referred to as a protist. Mosses…

Q: 10- There are many negative conséquences for a diet high in sodium. Explain how too much sodium in…

A: High salt intake over an extended period of time can raise blood pressure and increase the risk of…

Q: Compare the number and type of chambers found in fish, toad and human hearts – how do they differ?…

A: Humans and the majority of other animals depend on their hearts to stay alive. Examining the…

Q: Could monkeypox turn into a pandemic

A: Monkeypox is the latest global public health threat caused by the monkeypox virus. The monkeypox…

Q: systematics definition

A: The division/classification was based on some important features, what is the cell structure or…

Q: What mechanisms produce hypercapnia?

A: Hypercapnia, often referred to as hypercarbia and CO2 retention, is a state in which the blood's…

Q: ▶ Question 10 1 12 3 07 O 11 2n 11 10 6 8 and/or 8 7 In the figure above, which number represents…

A: Introduction: Gymnosperm flowers produce the pollen through the microsporangia of a male cone,…

Q: 10. Modify the diagrams below to reflect the activation and repression of lac operon. Use arrows,…

A: Lac operon contains genes involved in metabolism. The genes are expressed only when lactose is…

Q: how have microarrays demonstrated that, all cells of an organism have the same genome, some genes…

A: Lab-on-a-chip is another name for microarray. This method is used to simultaneously evaluate the…

Q: Which suite of reproductive features distinguishes angiosperms from gymnosperms? A. The carpel,…

Q: Plants store glucose as _____ and _____. starch; sucrose fructose; sucrose galactose; fructose…

A: The complexity of physical and chemical processes involved in photosynthesis, respiration, and the…

Q: A. Variation among individuals must be genetically transmissible to the next generation. B.…

A: Natural selection is the key process in the evolutionary mechanism. Here there is 4 major theories…

Q: A student prepared two beakers with identical sprigs of a water plant. She used the same size…

A: Most of the plants present in the Earth are photoautotrophic in nature. They make their own food for…

Q: Asexual plant probation cutting steps

A: Introduction Plants can reproduce naturally and artificially by various methods. Some lower plants…

Q: In DNA amplification, using the Taq polymerase, what is the maximum number of amplification cycles?…

A: Introduction In the field of molecular biology, however, cloning is viewed at a genetic molecular…

Q: Select an environmental issue related to public health. Based on the issue: What is the…

A: Introduction:- Health is defined as the physical and mental well being of an individual person.…

Q: Describe squamous cell carcinoma of the vocal cords.

A: Squamous cell carcinoma is a common type of skin cancer which starts appearing in the squamous cells…

Q: 4. The stage in mitosis in which chromosomes replicate themselves. A. Anaphase B Interphase D.…

A: Cell division is crutial process in all the organism both in unicellular or multicellular organism.…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: So yes?

A: Restriction enzyme that cuts double-stranded DNA into fragments after recognizing specific…

Q: What evidence supports the hypothesis that mitochondria preceded plastids in the evolution of…

A: Introduction Evolution is the key process that regulates the survivability and continuity of species…

Q: You read a research article presentsing new phylogenetic data demonstrating that species that…

A: Answer- Correct option is (A) Evolution of the pseudocoelom occurred more than once.

Q: Describe the effects of transcription factors on gene transcription

A: Transcription is a process by which the information of a strand of DNA is copied into a new molecule…

Q: in horses, a classic champagne colored horse and an amber champagned colored horse produce a golden…

A: Introduction :- The horse is a domesticated, hoofed mammal with unusual toes. It is one of the two…

Q: Directions: Use your basic knowledge of recombinant DNA technology to answer the question. Scenario:…

A: PCR(polymerase chain reaction) is a molecular method to make multiple copies(amplify) of a small…

Q: What is the minimum and maximum pH in which Enzyme X will work? What is the optimal (best) pH? Rate…

A: The enzymes are proteinaceous molecules that helps in accelerating the rate of the reaction that is…

Q: What happens when an ecosystem is in equilibrium?

A: In an ecosystem different organisms live together and interact with the environment. Ecosystem is…

Q: Genes provide the instructions for making...

A: This is a question related to genetics.

Q: The five different predator phenotypes will be represented equally at the start of the simulation.…

A: Predator-mediated phenotypic plasticity is commonly found in the nature. Phenotypes of prey species…

Q: The width of the mouth is equal to three times the vertical height of the eyes twice the width of…

A: Introduction Mouth, additionally called oral cavity or buccal cavity, in human life…

Q: Explain how the following factors affect the blood velocity and volume flow rate as well as…

A: Stroke is a medical emergency that occurs when the blood flow to the brain is interrupted. This can…

Q: How many different cell types are found in the human body?

A: There are trillions of different types and sizes of cells in the human body. These incredibly small…

Q: List the organs of the toad digestive tract from mouth to cloaca. If mammals use a different organ…

A: Introduction: The GI tract's main purposes are to prehension food and water, mastication,…

Q: Create a table the organelles, the cytoplasm, their location and their function a. mitochondria b.…

A: An organelle is a subcellular structure that, like an organ, performs one or more specific functions…

Q: Skin colour in dolphins is determined by a single gene showingincomplete dominance giving rise to 3…

A: Genes can be classified as dominant or recessive. Genes with dominant functions control what traits…

Q: Determine the differences between generalized and specialized transduction.

A: Transduction is one of the methods through which bacteria exchange genes from one bacterial strain…

Q: . Critically evaluate the role and reliability of different diagnostic methods in use for difficult…

A: I will be answering the above question by taking Infective endocarditis(IE) as an example:- IE is a…

Q: The buccal cavity of the toad will be dissected. When drawing this region what will you label your…

A: To study the anatomy of a frog we dissect it from the inner body surface that is found below the…

Q: ples, explain the three different degrees of dominance

A: Dominance takes many different shapes. The square root of the average degree of dominance is used to…

Q: What orchestrates cell differentiation? Why is cell differentiation important? What does it lead to?…

A: Introduction :- Unspecialized cells become specialised through the process of differentiation to…

Q: What is the function of a spliceosome?

A: Introduction: Prior to the RNA molecule being translated into a protein, introns are non-coding…

Q: Determine the gene sequence that is amplified by the use of primers in the polymerase chain…

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: Explain this example of the following water quality serial dilution. Note the dilution factors and…

A: Given information TNTC - Too many to count in plate 1:1 TNTC- in plate 1:10 10 cfu's= 1:100 1 cfu's…

Q: Sea otters importance

A: Introduction: Marine animals known as sea otters (Enhydra lutris) live along the coasts of the…

Q: Determine the reasons due to which the result indicates that horizontal gene transfer has taken…

A: A technique for transmitting genetic material between nearby microorganisms is called horizontal…

Question

Q8.A. Use Punnett square method to show the inheritance of deafness (d) which is inherited as a recessive trait. Analyze the result.
B. Refer to the figure below. Compute the percent (%) diversity of vertebrates and invertebrates. Show the solution. Round off % value to the nearest whole
number.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Solve the subparts 1,2,3.
1) REVIEW IMAGE 1 and IMAGE 4. Explain how adaptations increased the survival rate for rock pocket mice. In your response, use the words: Fittest and Natural Selection
Answer the following questions regarding adaptive and non-adaptive developmental plasticity: a) Define adaptive developmental plasticity, providing at least one example of a case study b) Define non-adaptive developmental plasticity, providing at least one example of a case study c) Describe at least one way in which adaptive developmental plasticity and non-adaptive developmental plasticity differ.
Give 3 examples of species with a continuum of strategies and provide their life history traits.
A.) Based on the graph, determine whether or not the fruit fly population is evolving. Justify your answer? B.) Described the frequency of the recessive allele over time. Make a hypothesis to explain what has affected the frequency of the recessives allele over time?
8 Analyze if the following pairs of statements are correct. Choose: A, if both statements are correct; B, if only the first statement is correct; C, if only the second statement is correct; or D, if both statements are incorrect. 2a. Population density refers to the number of individuals within a designated area. 2b. Richness pertains to the number of species present in a specific location.
based on the image attached a) Explain how genetic drift caused egg hatching to decrease in the late 1980s and 1990. b) Why did hatching improve following translocations? c) What are the general effects of gene flow between populations
ANSWER THE FOLLOWING ACTIVITY: a. What is Hardy-Weinberg Principle? b. What are the conditions that must be met for genetic equilibrium? LESSON 2 a. What are the various types of reproductive isolating mechanisms that can lead to speciation? b. What are the different modes of speciation? c. Explain how evolution produce the tremendous amount of diversity among organisms. LESSON 3 a. What is scientific classification? b. Why does biologist classify organism? c. Enumerate the scientist and cite their respective contributions in the development of evolutionary thought.
Describe 2 costs and 2 benefits to field primatology research and briefly explain 1 ethical dilemma that comes with working with primate ecosystems.
2. Identify an ancestral trait and a derived trait in mammals. Explain your answer.
Please help with the following: Prior to approximately 12 KYA, humans were hunter-gatherers and relied on wild plants and animals for subsistence. This means that their conscious manipulation of the genomes and gene pools of other organisms was essentially non-existent. 12KYA signaled the beginning of plant and animal domestication efforts. A. Two true statements; one false statement B. Two false statements; one true statement C. All True statements D. All False statements E. None of the above
please help with these two questions:Microevolution is best defined as which of the following? a. The transfer of genes between different species. b. The associations between traits between different species. c. The evolution of populations within a single species. d. Evolution above the species level. Evolutionary changes in beak size of Galapagos finches is associated with changes in which of these other traits? a. Bird migration b. Bird leg length c. Bird song d. Bird flight