C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector getSTRcounts(string& sequence, vector& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is {"AGAT", "AATG", "TATC"}, then the output is the vector {3, 7, 4} /** * Compares if two vectors of STR counts are identical or not * * @param countQuery STR counts that is being queried (such as that computed from an input DNA sequence) * @param countDB STR counts that are known for an individual (such as that stored in a database) * @returns a boolean indicating whether they are the same or not **/ bool compareSTRcounts(vector& countQuery, vector& countDB) For example, if countQuery is the vector {3, 7, 4}, and countDB is the vector {3, 3, 4}, the function returns false.
C++ Code:
This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be:
name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5
This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters.
- /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs)
For example, if the sequence is
AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG
and the vector namesSTRs is {"AGAT", "AATG", "TATC"}, then the output is the vector {3, 7, 4}
/** * Compares if two
For example, if countQuery is the vector {3, 7, 4}, and countDB is the vector {3, 3, 4}, the function returns false.
Trending now
This is a popular solution!
Step by step
Solved in 5 steps with 1 images
