Check your understanding about the following statements: I. Messenger RNA is a single-stranded molecule that carries the genetic information from DNA to the ribosome. II. Transfer RNAs convert the genetic information into defined amino acid sequences a. The first statement is true. The second statement is false. b. The first statement is false. The second statement is true. c. Both statements are true. d. Both statements are false.

Check your understanding about the following statements: I. Messenger RNA is a single-stranded molecule that carries the genetic information from DNA to the ribosome. II. Transfer RNAs convert the genetic information into defined amino acid sequences a. The first statement is true. The second statement is false. b. The first statement is false. The second statement is true. c. Both statements are true. d. Both statements are false.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter15: Dna Technology And Genomics

Section: Chapter Questions

Problem 7TYU

See similar textbooks

Similar questions

Which would be worse for an organism? Briefly explain your answer. B. The spliceosome can no longer form OR a particular gene has a mutation that removes the endonuclease site used in the addition of the polyA tail
A cDNA clone contains (a) introns (b) exons (c) anticodons (d) a and b (e) b and c
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
Now try this example yourself. Fill in the complementary mRNA sequence to the DNA sequence listed below: DNA sequence = C A T G C A C C G T T A C G A RNA sequence =
Evaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…
Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?
4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3' b) How many different mRNA sequences could code for the protein sequence you determined in 4a? Explain how you came up with your answer (don't write out all the possible mRNA sequences - just explain your logic). Can you help with 4a and sub question b
One of the concerns with GMO is the toxicity of product by GMO when consumed by humans. Suppose that the product is to block the 16S rRNA in the proakryotic small subunit, do you think it will have a high level of toxicity? Why? A. Yes, because the genetic code is universal. B. No, because the genetic code is NEARLY universal. C. No, because human ribosomes are different.
RNA can function: please explain your answer a.A) as a non-permanent template to synthesize protein b.B) to recruit the correct amino acid during translation c.C) as part of ribosomes to synthesize protein d.D) to help initiate DNA synthesis during replication e.Only A and C Only A, B and C A, B, C and D
BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…
Part A) In your own words describe what happens in transcription and translation Include which types of nucleic acids are involved in each step Describe the function of each type of nucleic acid in the process of making proteins Part B) Also, explain how two nucleic acids "recognize" or "talk" to each other
1. how is information from the DNA passes on from one cell to another?2. How does the structure of a DNA molecule hellp account for the great variety of life that exists on earth?3. Does your mRNA model more closely resemble the DNA strand from which it was transcribed?4. Explain how the structure of DNA enables the molecule to be easily transcribed. Why it is important for genetic information?5. Why is RNA important to the cell?6. How does the mRNA molecule carry information from DNA?