Compare chronic bronchitis and emphysema with respect to location of each disease within the respiratory tract and discuss the pathophysiology of each disease. Include an explanation (reason) for the signs and symptoms present in each lung condition

Q: The following is a picture of Eosin Methylene Blue Agar. What does the growth on this plate…

A: Eosin Methylene Blue (EMB) agar is a selective and differential culture medium which selectively…

Q: One of the buffers that contribute to pH stability in human blood is carbonic acid (H₂CO3). Carbonic…

A: Introduction   The normal pH of blood is 7.4 which is near to neutral and slightly basic.  the…

Q: This molecule is closely associated with the intrinsic pathway of apoptosis Group of answer choices…

A: The process of programmable cell death is called apoptosis. Unwanted cells, such as those between a…

Q: Ch. 7: Hydronephrosis can be caused by: a) renal calculi Ob) tumors c) benign prostatic hyperplasia…

A: The ailments that lead to hydronephrosis most frequently in adults are as follows: Stones that can…

Q: distal collecting tubules

A: Reptile kidneys are relatively simple in structure compared with birds and mammals. They contain…

Q: Ch. 7: Which type of renal calculi can be dissolved by raising urine pH with potassium citrate? a)…

A: INTRODUCTION Renal calculi It is hard depositions of minerals and acid salts formed in kidney and…

Q: In addition to pyruvate dehydrogenase, which of the following enzymes is also a regulatory site in…

A: Cellular respiration is a metabolic process in which glucose molecule is broken down and eventually…

Q: apply the knowledge of the molecular structure and function of DNA, RNA and proteins to understand…

A: "JJ has a novel therapy for Sickle Cell Disease called Voxelotor (Oxbryta)". By enhancing…

Q: Hemocytes are stem cells which become plasma cells of the white blood cell system. These cells…

A: The rough endoplasmic reticulum produces secretory proteins and membranes. Through the process of…

Q: Ch. 6: Hypocalcemia is due to an imbalance of: a) parathyroid hormone Ob) growth hormone O c)…

A: When your blood calcium levels are too low, you have hypocalcemia, a disorder that is treatable.…

Q: Our understanding of the molecular biology of cancer formation has been greatly enhanced by studying…

A: The genes which cause cancer when mutated are called as oncogenes. The genes which are mutated to…

Q: The answers may be used once, more than once or not at all. Deepest parts of the ocean, trenches…

A: Introduction Scientists believe that million of years ago, all continents were in the form a single…

Q: Which structure is the the site of the synthesis of proteins that will be used inside the cell?  a.…

A: Proteins are essential biomolecules composed of adjoining monomer units "amino acids" via "peptide…

Q: The evolution / development of the skeletal system of the vertebrate is an example of the process of…

A: Osteoblasts create both endochondral and intramembranous bones, whereas osteoclasts destroy the…

Q: Ch. 8: Which of the following is UNLIKELY to improve the symptoms of premenstrual syndrome? a)…

A: Premenstrual syndrome (PMS) is a collection of physical and emotional symptoms that occur in the…

Q: In step 6 of the Krebs cycle succinate ___ to fumerate a reaction that takes place in the ___…

A: Succinate is changed into fumarate in the sixth stage, where two protons are taken out, resulting in…

Q: Why does a precipitate form on Sierra's medium when incoulated with a lipolytic organism?

A: Microbial media are special growth medium that enables the growth of bacteria. it contains all the…

Q: Which of the following are found in plants but NOT in animals? a. Mitochondria b. Nuclei OC. RER Od.…

A: Cell organelles are important components of eukaryotic cells. These are small sub-cellular…

Q: rate of reaction

A: The molecule upon which an enzyme acts is called a substrate. The chemical reactions involving the…

Q: Which of the following summarizes the role of calcium in muscle contraction? opens the binding sites…

A: The actin's active-binding sites are made visible by calcium ions attaching to the protein complex…

Q: Discuss health effects of carbon monoxide and PM2.5  exposure among the traffic police workforce. As…

A: Pollution has a wide-ranging impact on living species as well as economic systems that rely on the…

Q: The mutation of which of the following proto-oncogenes can lead to an increased susceptability to…

A: Introduction:- Cancer or malignancy is defined as the uncontrolled and unregulated proliferation of…

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: What is  the relationship between the structure and function of proteins and how are they are…

A: Proteins are made up of a very long chain of many amino acids. Even with a limited no. of amino acid…

Q: CD4 cells are cells and CD8 cells are cells A killer, suppressor B helper, cytotoxic C cytotoxic,…

A: Introduction: Our immune system's lymphocytes are a subset of white blood cells. There are two of…

Q: Which of the following are methods of regulating hydrogen ion concentration in blood? all that…

A: An interconnected set of mechanisms maintains the extracellular hydrogen ion concentration almost…

Q: Anti-A antibodies are added to a blood sample to detect Anti-B antibodies are added to a blood…

A: Introduction :  There are some proteins in the blood called antibodies and antigens which differ…

Q: Scientists identify a tumor cell in rats that divides more rapidly in the presence of galactose.…

A: Tumor is a kind of lump which is created by the cells dividing uncontrollably. Uncontrolled cell…

Q: Human embryonic stem cells are Plant cells are

A: Human embryonic stem cells are valuable tools. They help in developing an understanding of the…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: 23. Explain the relationship between DNA, genes, alleles, and traits. Alleles are also genetic…

A: 23. Deoxyribonucleic acid, or DNA, is a biological macromolecule that carries hereditary information…

Q: Ch. 6: The laboratory sends you these ABG results for your patient: pH 7.32, PaCO2 40 mmHg, and…

A: INTRODUCTION ABG Analysis This is arterial blood gas analysis. It measure the amount of arterial…

Q: A scientist wants to make a random mutation in a specific gene to investigate that gene's function.…

A: A random mutation is a change in the sequence of nucleotides that makes up an organism's genetic…

Q: In animal cells, Cyclin D/CDK2 act to drive cells through the restriction point in G1. True or…

A: This is the question of cell division. Basically cell division consist of two phase interphase &…

Q: Describe characteristics of Proteus Vulgaris in the Agar: (How does colonies look like (color) and…

A: Proteus vulgaris is a gram negative, rod shaped, facultative anaerobic and heterotrophic, and…

Q: 2. Na+ K+ CI A™ The diagram below shows two electro-neutral solutions separated by a membrane. Other…

A: The equilibrium potentials of the ions to which the membrane is permeable are represented by the…

Q: (8) After training, the mice with knock-in of the human version of the CMAH gene (which has lost…

A: Humans are exceptional long-distance runners when compared to other primates. This trait first…

Q: Ch. 6: The major buffering system of the extracellular fluid (ECF) is: a) the bicarbonate-carbonic…

A: Introduction Buffer is the solution that resists the change in pH when an acidic solution or a basic…

Q: (no) 8. A manx mouse with blue fur is crossed to a long-tailed, black mouse heterozygous for color.…

A: Let the dominat allele for black fur be denoted as B and recessive (blue) as b. Aslo, let dominant…

Q: QUESTION 17 When changing overload, which is the prudent decision? OA. for unfit individuals, change…

A: 17) Overload refers to the concept of gradually increasing the demands placed on the body during…

Q: The function of the lysosome is to Select one: a. remove ubiquitinated proteins b. make proteins c.…

A: Macromolecules are disassembled by lysosomes into their component parts, which are then recycled.…

Q: Question 25 Which of the following would you expect to see when comparing the genomes of two…

A: Our genome is made up of about 3 billion base pairs of DNA that make us who we are. DNA sequences…

Q: How does the body regulate blood glucose

A: Introduction Maintenance of blood glucose level is very important to maintain the homeostasis in the…

Q: Ch. 8: An emergency situation in which an erection is prolonged for more than for more than four…

A: An extended penile erection is referred to as priapism. The complete or partial erection lasts for…

Q: Which of the following describes the self-tolerance of adaptive immunity?   A)  a given immune…

A: The immune system's capacity for self-tolerance is its capacity to see its own antigens as…

Q: Which of the following best summarizes the relationship between condensation reactions and…

A: All living cells undergo certain chemical reactions to Work properly, those can be, catabolic…

Q: es Classify the following characteristics according to whether they describe typical cells or cancer…

A: The cell is the functional unit of life. It is composed of various small sub cellular level…

Q: Cystic fibrosis is an autosomal recessive disorder. The frequency of CF in Ontario is 1 in 3,000.…

A: In the given case, the frequency of population having homozygous dominant, homozygous recessive and…

Q: Ch. 7: Observing Potter facies in a newborn could be a sign of: a) Wilms tumor b) polycystic kidney…

A: Introduction: As a result of oligohydramnios while in the uterus, babies can have an unusual…

Q: Potential negative effects of rapid weight loss through fasting or crash dieting include... Group of…

A: Introduction:- Biomolecules are required by our body for cellular growth and maintenance. These are…

Respiratory Infections

Respiratory infections are infectious diseases of the respiratory tract that are mostly caused by bacteria and viruses. They cause infections of the throat, sinuses, airway path, and lungs. Respiratory infections are typically divided into two types: upper tract respiratory infection and lower tract respiratory infection.