Consider the below commands i) sed “s/CSH/csh/g" temp >|ls ~/newtemp ii) Is -v grep wc -l iii) Is -a | grep “." | wc -1 iv) type -l export | type -t Is לל CG Which of the above Commands are executed? (A) i, ii, iii only (B) ii, iii only (C)All the above (D)None of these

Consider the below commands i) sed “s/CSH/csh/g" temp >|ls ~/newtemp ii) Is -v grep wc -l iii) Is -a | grep “." | wc -1 iv) type -l export | type -t Is לל CG Which of the above Commands are executed? (A) i, ii, iii only (B) ii, iii only (C)All the above (D)None of these

Name: Consider the below commandsi) sed “s/CSH/csh/g" temp >|ls ~/newtempii
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: Consider the below commandsi) sed “s/CSH/csh/g" temp >|ls ~/newtempii) Is -v grep wc -liii) Is -a | grep “." | wc -1iv) type -l export | type -t Isלל CGWhich of the above Commands are executed?(A) i, ii, iii only(B) ii, iii only(C)All the above(D)No

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter3: Input/output

Section: Chapter Questions

Problem 1PE: 1. Consider the following incomplete C++ program: #include <iostream> int main() { … } a. Write a...

See similar textbooks

Similar questions

15. Consider the following function:def f(aList):print(aList)alist.append(3)Suppose that function f() has been defined and that you are executing the belowsequence of commands in the IDLE shell:lst = [1]f(lst)f(lst)f(lst)What is printed when the code is executed?Show the contents of lst after all the above code has run:
Question 40. Consider the following code chunk: import random x=0while(x < 4): x = random.choice([1, 2, 3]) print(x) It is not a good idea to run these lines because...a) x is an invalid argument to print().b) the condition x < 4 is never violated.c) the function random.choice() does not exist. d) x is initialised with the wrong type.
Compliant/Noncompliant Solutions The following code segment was provided in Secure Coding Guidelines for Java SE: void readData() throws IOException{ BufferedReader br = new BufferedReader(new InputStreamReader( new FileInputStream("file"))); // Read from the file String data = br.readLine();} The code is presented as a noncompliant coding example. For this assignment, identify two compliant solutions that can be utilized to ensure the protection of sensitive data. Provide a detailed explanation of factors, which influence noncompliant code and specifically how your solutions are now compliant. Your explanation should be 2-3 pages in length. Submit the following components: Word document with appropriate program analysis for your compliant solutions and source code in the Word file. Submit your .java source code file(s). If more than 1 file, submit a zip file.
IN SCALA PLEASE COULD YOU COMPLETE THE CODE OF FUNCTIONS: get_csv_url, process_ratings, process_movies, groupById, favourites, suggestions and recommendations import io.Source import scala.util._ // (1) Implement the function get_csv_url which takes an url-string // as argument and requests the corresponding file. The two urls // of interest are ratings_url and movies_url, which correspond // to CSV-files. // // The function should ReTurn the CSV-file appropriately broken // up into lines, and the first line should be dropped (that is without // the header of the CSV-file). The result is a list of strings (lines // in the file). def get_csv_url(url: String) : List[String] = ??? val ratings_url = """https://nms.kcl.ac.uk/christian.urban/ratings.csv""" val movies_url = """https://nms.kcl.ac.uk/christian.urban/movies.csv""" // testcases //----------- //: //val movies = get_csv_url(movies_url) //ratings.length // 87313 //movies.length // 9742 // (2) Implement two functions that…
The following code must be written in python for this HW assignment. I will provide a skeleten for the code and you must write some lines of code to satisfy the objective of the prorgram. You will develop a web server that handles one HTTP request at a time. Your web server should acceptand parse the HTTP request, get the requested file from the server’s file system, create an HTTP responsemessage consisting of the requested file preceded by header lines, and then send the response directly tothe client. If the requested file is not present in the server, the server should send an HTTP “404 NotFound” message back to the client. Put an HTML file (e.g., HelloWorld.html) in the same directory that the server is in. Run the serverprogram. Determine the IP address of the host that is running the server (e.g., 128.238.251.26). Fromanother host, open a browser and provide the corresponding URL. For example:http://128.238.251.26:6789/HelloWorld.html‘HelloWorld.html’ is the name of the file you…
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
Hello, I am having an error and cannot figure out how to solve this question. Could someone please assist? Please be advised, I am using PostgreSQL as that is what was used in class. Thus, I must use PLPGSQL Code CREATE OR REPLACE FUNCTION Moreno_03_bankTriggerFunction()RETURNS TRIGGERLANGUAGE PLPGSQLAS$$CREATE TRIGGER Wise_12_bankTriggerAFTER DELETE ON accountFOR EACH ROW EXECUTE PROCEDURE Moreno_15_bankTriggerFunction();
Choose the correct option 1)Which functions allow to change the location of the get and put positions ?a)sg() and sp()b)sekg() and sekp()c)gog() and gop()d)seekg() and seekp() 2)Which of the following operator is used to release the dynamically allocated memory in CPP?a) removeb)freec)deleted)both b and c 3) Local variables are stored in an area called ___________a) Heapb) Permanent storage areac) Free memoryd) Stack 4)Choose the correct option?#include<iostream>using namespace std;class Base {};class Derived: public Base {};int main(){Base *bp = new Derived;Derived *dp = new Base;}a. No Compiler Errorb.Compiler Error in line “Base *bp = new Derived;”c. Compiler Error in line ” Derived *dp = new Base;”d. Runtime Error 5)When the inheritance is private, the private methods in base class are __________ in the derived class (in C++).a. Inaccessibleb.. Accessiblec.. Protectedd. Public
Problem Given the target file f0 and candidate files f1-f20, there is an identical copy of f0 among the files f1-f20. Write a python program to perform the following tasks: · Read in each file and calculate the hex hash values by using SHA3 function with the length of 512 for all the given files f0, f1-f20. · Save the hex hash values of each file as a new line in a .txt file named hash.txt file. · Read hash values from hash.txt and compare them to find the identical copy of f0 among f1-f20. · Write the finding result (the matched file name) back to hash.txt Submission • Name your project fileHash.py and submit both fileHash.py and hash.txt on Blackboard. • The program should be properly documented. • The program should have user friendly Input/Output design • Duplicate work (or obviously similar one) will result in an F grade in the course. Grading 1. Include comments as specified in the course syllabus. (10%) 2. Source code and results. · Correctness (70%) · User-friendliness…
In C#: Create a function that takes in one argument: The url to an API endpoint. The function should make the API call and pull the data in, convert it to a dictionary, and pull out the number of kills from the last 7 games the user played. The function should return the sum of the top five number of kills from these games. Call Of Duty API: https://rapidapi.com/elreco/api/call-of-duty-modern-warfare
Write a function which takes in a pandas dataframe and returns a modified dataframe that includes two new columns that contain information about the municipality and hashtag of the tweet. Function Specifications: Function should take a pandas dataframe as input. Extract the municipality from a tweet using the mun_dict dictonary given at the start of the notebook and insert the result into a new column named 'municipality' in the same dataframe. Use the entry np.nan when a municipality is not found. Extract a list of hashtags from a tweet into a new column named 'hashtags' in the same dataframe. Use the entry np.nan when no hashtags are found. Hint: you will need to mun_dict variable defined at the top of this notebook. ```
--& 10. Create a function based on the following information: Your mission is to encrypt a secret message (text only, without special chars like "!", "&", "?" etc.) using Caesar cipher where each letter of input text is replaced by another that stands at a fixed distance. For example ("a b c", 3) == "d e f" Input: A secret message as a string (lowercase letters only and white spaces) and number to move text Output: The same string, but encrypted Return: The same string, but encrypted.