Describe the proximity in time, similarity in timbre, pitch and good continuation?   How are these important for auditory object recognition?

Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…

A: When the evolution of different organisms or species from a common ancestor is depicted through a…

Q: To explain: Which component does the KDEL receptor bind its ligand more tightly and more weakly.

A: Proteins are the fundamental building blocks of many biological structures, including cell…

Q: Q4) The relative volume of red blood cells can be known by measuring the hematocrit (the ratio…

A: Blood  It is a type of connective tissue that connects whole body. It carry oxygen to every cell of…

Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…

A: Appendix is a thin, finger-shaped pouch about 4 inches long that projects out from the colon in the…

Q: pure-breeding yellow (Y) canaries crossed with pure breeding blue (y)  canaries make green…

A: Inheritance is the process by which genetic information is passed on from parent to child.

Q: VENTILATION FOR PREVENTING PROPAGATION OF POLLUTANTS THROUGHOUT THE ROOM 1. aeration 2. general…

A: Pollutants are defined as the elements or particles that are major contributors to pollution.  These…

Q: To explain: How would an uncoupler Dinitrophenol of oxidative phosphorylation promote weight loss.

A: The organic chemical compound 2,4-dinitrophenol (DNP) It is a biochemically active chemical that…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A:

Q: 1. THE EFFICIENCY OF NATURAL VENTILATION IS DETERMINED BY 1. the content of carbon dioxid 2. the…

A: Natural ventilation is a way of delivering clean air to a building or space using passive factors…

Q: In photosynthesis which percentage of oxygen produced is used for cellular respiration in the plant?…

A: The oxygen that is released in the photosynthesis is used in the cellular respiration by the plants.…

Q: Examine the family pedigree. What is the probability that their next child will have dry air wax?…

A: Pedigree  Pedigree is a chart or diagram that show the occurrence and appearance of any gene of…

Q: Label the structures of the lymphatic system in the accompanying figure. ch Lymphatic vessel…

A: Lymphatic system Lymph is a colourless fluid that contains the immunity cells or the white blood…

Q: 30-40% of all type 1 DM patients develop nephropathy in years

A: Diabetes can cause diabetic neuropathy, which is a kind of nerve injury. High blood sugar (glucose)…

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: The photochemical and electron transport reactions of photosynthesis process occur at the thylakoid…

Q: Calculate the estimated concentration of test agent that inhibit cell growth by 50% ( GI50) value

A: Temozolomide is a drug used to treat certain types of brain tumors. It belongs to a class of…

Q: discuss the practical use of colonial morphology and cellular morphology in the identification of…

A: Please follow step 2 for detailed explanation.

Q: In vertebrates, there exist a double circulation. What are these and explain each in the terms of…

A: Introduction The circulatory system pumps blood from the heart to the lungs to get oxygen, An…

Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…

A: Muscle tissue is made up of cells that contract when they are stimulated. When the muscle cells are…

Q: Calcitonin is enzyme that functions to reduce blood calcium levels

A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…

Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16

A: Frog muscles:  In frogs different types of muscles can be found that help the frog in performing…

Q: To examine: whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein phosphatases are the enzymes which are involved in controlling diverse array of processes in…

Q: what microbial features would you use a scanning electron microscope and transmission electron…

A: Scanning electron microscope   special features- projects 3D image of surface   Appearance of the…

Q: Consider the tradeoffs between having a living exterior with guard cells vs. a thick layer of…

A: Cuticle is a waxy, water-resistant covering on a leaf's surface that prevents water loss. It covers…

Q: To brachiate is to O move around suspended from branches like a Siamang to leap from tree to tree…

A: Evolution can be defined as the unrolling of nature that brings about an orderly change from one…

Q: HIV can be treated with therapy, but there is a growing in the level of innate  immune activation…

A: Inanate immune system constitute first line of defense to HIV virus, paatern of association is the…

Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…

A: Under anaerobic conditions, yeast uses its nutrition to produce energy. Yeast cells cannot undergo…

Q: The addition of monomeric units to one end of a polymer and their removal from the opposite end such…

A: Introduction The cytoskeleton of a cell is made up of intermediate filaments. actin filaments and…

Q: After Eating a pizza Tomatoes and Pizza Dough =Producers – 10,000 or 20,000 Cheese – Primary…

A: The food chain is the arrangement of organisms in a linear sequence in which the nutrients and…

Q: B. Cholesterol mainly occurs in the cell walls of mammalian cells

A:

Q: what are the differences between the three-domain and five-kingdom schemes of biological…

A: The Linnaean system (1758) classified all macroscopic living organisms as either Animals or Plants,…

Q: The diagram below represents results of agarose gel electrophoresis performed after PCR…

A: Please follow step 2 for detailed explanation.

Q: In the adaptive immune response which antigen are mount cellular responses? T helper lymphocytes T…

A: Answer

Q: Distinguished between open and closed circulatory system, and discuss their effectiveness in…

A: All multicellular animals need a circulatory framework to transport oxygen and supplements through…

Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein phosphatases (PPs) regulate a wide range of signalling systems in plants, and their blockage…

Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…

A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…

Q: 3. Estimate the flow resistance in a small arteriole (lumen diameter 25 microns; length 0.1 cm) for…

A: Introduction The proportion of red blood cells in your blood is measured by a hematocrit test. Your…

Q: 7. A nail driven into the side of a tree will remain at exactly the same distance from the ground…

A: Angiosperms: Flowering plants, also known as angiosperms, are plants that produce flowers and…

Q: Two pea plants with the following genotypes are cross fertillized. RrSsTtVv X RrssTTVv calculate the…

A: A genotype is an individual's gene collection. A genotype is defined as a person's collection of…

Q: 9. Which of the following is/are the sign(s) of renal malfunction? I. Renal clearance of creatinine…

A: Urinary system is a type of body system which generally involved in formation of urine and it's…

Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…

A: Kin selection favors the reproductive success of the other relatives even at a cost to the…

Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…

A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…

Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…

A: These are term related to animal diversity.

Q: Ray-finned fish Rodents & rabbits Crocodiles Birds Sharks Amphibians Primates Hair Eggs with shelle…

A: The phylogeny tree is given in the image. It depicts the relationship between the taxons present in…

Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…

A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…

Q: ***Express your opinion on the idea:    The possibility of a single locus in a DNA to code for…

A: Ya this is possible, if a single locus can produce multiple mRNA sequences after splicing, depending…

Q: In cattle, the gene for hornless (H0 is dominant to the gene for homed h), the gene for black (8) is…

A: Given: In cattle, Gene for hornless (H) is dominant to the gene for horned (h). The gene for black…

Q: To examine: Whether the statement, “The number of c subunits in the rotor ring of ATP synthase…

A: ATP, or adenosine triphosphate, is an organic molecule that provides energy during various metabolic…

Q: II. The base composition of a single stranded DNA, which is 1000 bases long is the following: A =…

A: A parent DNA molecule makes two DNA double helix in a single round of DNA replication.

Q: What type of transporter moves glucose into the cell against its concentration gradient? A. K+ -…

A: Sodium Potassium pump is a very important criteria for the movement of glucose molecules against the…

Q: 2. Why do we use samples in the collection of data?

A: A research proposal is a document that specifies the aims of their research and the techniques that…

Communication

Communication is a method of transferring information between two persons or organisms. Communication is possible using mutually understood behaviors such as signs, symbols, or language. In the year 1980, S. F. Scudder proposed communication theory. According to his ideas, all living beings on the earth communicate, but the methods of communication differ. Communication skills are now part of soft skills.