e) (2a + 5b) ^ 3 * (x - 7y) ^ 4 f) Evaluate the binary expression tree in e) using the arrows method. Assume a=1, b=0, x=2, y=0 BOX IN YOUR ANSWER
Q: The Problem: When your dealing with small programs it's OK to log everything. If you have a larger…
A: Logging is the practice of recording events or actions that occur during the execution of a program…
Q: A machine cycle, commonly referred to as a process loop, is made up of these four individual…
A: A machine cycle, also known as a process loop or instruction cycle, is a fundamental concept in…
Q: Cloud computing must be used to open innovation in your presentation.
A: Cloud computing has revolutionized the way organizations manage their data and computing needs. It…
Q: When a complete inventory of the mathematical operations has been gathered, they ought to be…
A: One should agree that it is important to organize mathematical operations in a logical fashion…
Q: Consider the problems and risks of each possibility while building the framework. Cloud computing: a…
A: Due to its many benefits, including scalability, affordability, and accessibility, cloud computing…
Q: You need to be able to provide your own working definition of System Dynamics. It is important that…
A: We must first define System Dynamics. We must also clarify How are mathematical equations used in…
Q: Agile software development which method works best?
A: According to the information given:- We have to define Agile software development: which method…
Q: What makes the Internet a remarkable ICT? Several methods to show this.
A: The Internet is a remarkable ICT because it connects people globally,provides easy access to…
Q: Three new, beneficial Internet of Things applications are emerging.
A: We have to discuss Three new, beneficial Internet of Things applications are emerging.
Q: Write assembly code that multiplies the low 4-bit and high 4-bit values of the value at address 58h.…
A: Write a program in assembly language that multiplies the low 4-bit and high 4-bit values of the…
Q: Windows 2008 Active Directory and DNS Setup
A: The Windows NT family of operating systems includes Microsoft's Windows Server 2008, which is an…
Q: It is the job of the administrator of the computer system to make sure that updated versions of…
A: As the administrator of the computer system, it is your responsibility to guarantee that software…
Q: What makes the Internet a remarkable ICT? Several methods to show this.
A: The Internet has become indispensable to our daily existence, facilitating global communication,…
Q: Discuss workplace tablet and smartphone usage.
A: Wherever Data Exists, customers, clients, and employees must update their information. Tablets and…
Q: How do classical computers and quantum computers interact, and what are the fundamental distinctions…
A: Answer is explained below
Q: The "type" of a variable cannot be declared alone; this is inadequate. The data type of a variable,…
A: Using only the "type" keyword to declare a variable is inadequate. The data type and other…
Q: Before covering the four biggest discoveries, quickly introduce continuous event simulation.
A: Continuous event simulation is a type of computer simulation that models dynamic systems where…
Q: What's a computer network's internal operation and benefits? How does the network work? Explain why…
A: A network of computers and other electronic devices that can exchange and use data is called a…
Q: Layer-2 protocol-deficient routers? Why don't PPP-encapsulated routers' serial interface subnets…
A: Layer 2 protocol problems on routers may arise for a number of causes, such as incorrect setup,…
Q: Explain why you chose the particular machine learning model that you did rather than another one.…
A: Before discussing situations in which one machine learning model may be preferred over another, it…
Q: uggest and discuss a short awareness program to protect kids from scammers.
A: Scammers use various tactics to exploit vulnerable people, including children. Children are…
Q: Before starting to build the framework, think about the difficulties you'll encounter and…
A: The creation of a framework may present numerous obstacles. There are issues with scalability,…
Q: As a result of the fact that the terms "computer architecture" and "computer organisation" seem to…
A: Computer architecture and organisation are often synonymous, but they refer to two distinct concepts…
Q: Does the agile approach favor a certain architecture?
A: The Agile methodology is a widely-used software development approach that prioritizes adaptability,…
Q: Using particular instances, describe why you would choose one machine learning model over another.…
A: Using particular instances, describe why you would choose one machine learning model over another.…
Q: Educate yourself on the difference between iterated, authoritative, and root DNS requests
A: Domain Name System (DNS) is a hierarchical decentralized naming system for computers, services, or…
Q: SDN controllers first.
A: SDN, or Software-Defined Networking, is a modern approach to computer networking that allows…
Q: ting must be used to open innovation in your present-
A: When companies work with third parties to develop and launch new products and services, they are…
Q: Explain "cybercrime". Provide three examples of good and bad online activity.
A: Cybercrime refers to criminal activities that are conducted online or through the use of computer…
Q: Differentiate the key features that set real-time and non-real-time computer operating systems…
A: Operating systems for computers are the software programmes that oversee and direct all of the…
Q: How different are each of these different kinds of cloud services from one another? According to…
A: Software as a Service (SaaS), Platform as a Service (PaaS), and Infrastructure as a Service are the…
Q: Which of these many aspects has an effect on the way the network functions?
A: A network consists of a collection of linked devices or nodes that may communicate with one another…
Q: Please provide concrete examples showing how calls and returns fit into the bigger picture
A: Calls and returns are fundamental concepts related to functions and procedures in programming. A…
Q: Does public face recognition without customer permission violate the ACM code of ethics and conduct?
A: => The ACM Code of Ethics and Professional Conduct is a set of guidelines and principles…
Q: Many software components are copied on each node in a distributed system. What precisely does it…
A: Replicas of failed nodes will keep the distributed network running. Thus, system failure tolerance…
Q: would appreciate it if you could offer a concise overview of virtualization as well as the Linux…
A: Virtualization is the creation of a virtual version of something, such as an operating system, a…
Q: Layer-2 protocol-deficient routers? Why don't PPP-encapsulated routers' serial interface subnets…
A: Layer-2 protocol-deficient routers lack support for Layer-2 protocols and need additional…
Q: Please summarise the a.NET security suggestions in little more than 200 words so that we may benefit…
A: Always use the most recent stable version of the.NET Framework and runtime, as well as any…
Q: Discuss workplace tablet and smartphone usage.
A: Anywhere There Is Information The data of customers, clients, and employees must be updated.…
Q: Find out more information about the Bottler Company's efforts to protect its messaging systems using…
A: IPsec is a suite of protocols used to secure internet communications by authenticating and…
Q: Computer architecture's top eight concepts: how important?
A: Here is your solution -
Q: In the context of internet safety, describe the ways in which public behaviour has altered as a…
A: Advances in technology have led to significant changes in public attitudes towards Internet…
Q: With how much information these businesses already have on their customers, it's difficult to see…
A: As businesses continue to collect more information about their customers, some consumers are…
Q: What are apps and why do we need them in this day and age?
A: Apps, short for applications, are software programs designed to run on mobile devices, desktop…
Q: The ideal gas law allows the calculation of volume of a gas given the pressure(P), amount of the gas…
A: The question does not specify any particular programming language for the solution. We have done the…
Q: Which two UML diagrams are most common? Why?
A: UML provides a variety of diagrams for representing different aspects of software systems. However,…
Q: SDN controllers first.
A: This question is about SDN controllers and especially computer networking. To facilitate…
Q: abc F 000 1 001 1 010 0 011 1 100 1 101 0 110 0 111 0
A: In boolean algebra,The logic gate which performs the logical multiplication of binary input signals…
Q: Before moving on to the discussion of the four most important discoveries, provide a quick…
A: What is simulation and continuous event in 70 words Simulation is a technique for creating a model…
Q: Examine how desktop and mobile app users solve problems. Consider many alternatives to assist…
A: Desktop and mobile app users approach problem-solving differently due to differences in device size,…
e) (2a + 5b) ^ 3 * (x - 7y) ^ 4
f) Evaluate the binary expression tree in e) using
the arrows method. Assume a=1, b=0, x=2, y=0
BOX IN YOUR ANSWER
Step by step
Solved in 3 steps with 1 images
- Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT22.........a) Write a program that asks the user to enter the number of vertices in a directed graph and then the adjacency matrix representing the directed graph. The program, then, must display the node with the highest outdegree. Assume that nodes are named as 0, 1, 2, and so on.asapHomework#7-a Compute the value of factorial 10 using (for) loop. """""""""""""""""""""""""""""""""""""""""""" Homework#7-b Create a square identity matrix using (while) loop, (continue) and (break) . Note: if you want to use (while) loop without condition, you can write, as example: n=5 While n in this case the loop will continue without a condition on (n) value.
- Recursive Binary Search Instructions The binary search algorithm given in this chapter is nonrecursive. Write and implement a recursive version of the binary search algorithm. The program should prompt Y / y to continue searching and N / n to discontinue. If an item is found in the list display the following message: x found at position y else: x is not in the list Use the following list of integers when testing your program: 2, 6, 8, 13, 25, 33, 39, 42, 53, 58, 61, 68, 71, 84, 97Algorithm design with sorting. Each of n users spends some time on a social media site. For each i = 1, . . . , n, user i enters the site at time ai and leaves at time bi ≥ ai. You are interested in the question: how many distinct pairs of users are ever on the site at the same time? (Here, the pair (i, j) is the same as the pair (j, i)).Example: Suppose there are 5 users with the following entering and leaving times: Then, the number of distinct pairs of users who are on the site at the same time is five: these pairs are (1, 2), (1, 3), (2, 3), (4, 6), (5, 6). (Drawing the intervals on a number line may make this easier to see).(a) Given input (a1 , b1),(a2 , b2), . . . ,(an, bn) as above in no particular order (i.e., not sorted in any way), describe a straightforward algorithm that takes Θ(n2)-time to compute the number of pairs of users who are ever on the site at the same time, and explain why it takes Θ(n2)-time. [We are expecting pseudocode and a brief justification for its…String Pair // Problem Description // One person hands over the list of digits to Mr. String, But Mr. String understands only strings. Within strings also he understands only vowels. Mr. String needs your help to find the total number of pairs which add up to a certain digit D. // The rules to calculate digit D are as follow // Take all digits and convert them into their textual representation // Next, sum up the number of vowels i.e. {a, e, i, o, u} from all textual representation // This sum is digit D // Now, once digit D is known find out all unordered pairs of numbers in input whose sum is equal to D. Refer example section for better understanding. // Constraints // 1 <= N <= 100 // 1 <= value of each element in second line of input <= 100 // Number 100, if and when it appears in input should be converted to textual representation as hundred and not as one hundred. Hence number…
- def convert_data(data: List[list]) -> None: """Convert each string in data to an int if and only if it represents a whole number, and a float if and only if it represents a number that is not a whole number. >>> d = [['abc', '123', '45.6', 'car', 'Bike']] >>> convert_data(d) >>> d [['abc', 123, 45.6, 'car', 'Bike']] >>> d = [['ab2'], ['-123'], ['BIKES', '3.2'], ['3.0', '+4', '-5.0']] >>> convert_data(d) >>> d [['ab2'], [-123], ['BIKES', 3.2], [3, 4, -5]] """ an easier way to do this for begniners5.19 LAB: Adjust list by normalizing When analyzing data sets, such as data for human heights or for human weights, a common step is to adjust the data. This can be done by normalizing to values between 0 and 1, or throwing away outliers. For this program, adjust the values by dividing all values by the largest value. The input begins with an integer indicating the number of floating-point values that follow. Assume that the list will always contain less than 20 floating-point values. For coding simplicity, follow every output value by a space, including the last one. And, output each floating-point value with two digits after the decimal point, which can be achieved as follows:printf("%0.2lf ", yourValue); Ex: If the input is: 5 30.0 50.0 10.0 100.0 65.0 the output is: 0.30 0.50 0.10 1.00 0.65 The 5 indicates that there are five floating-point values in the list, namely 30.0, 50.0, 10.0, 100.0, and 65.0. 100.0 is the largest value in the list, so each value is divided by 100.0.…3.3.2: Nested loops: Print seats. Given numRows and numColumns, print a list of all seats in a theater. Rows are numbered, columns lettered, as in 1A or 3E. Print a space after each seat, including after the last. Use separate print statements to print the row and column. Ex: numRows = 2 and numColumns = 3 prints:1A 1B 1C 2A 2B 2C
- 5-Star Restaurant by Jay Vince Serato I'm running a 5-star restaurant and I can only have the best items on my menu. My menu offers 6 items, each represented by a number from 1-6. If an item on my menu does not sell or does not sell that much compared to others, I must act and replace it with something that sells! Identify which dishes do not sell. If every dish sells, print the set of dishes that were ordered least. Input A single line containing the dish number that were ordered. Treat as one number. 156356231 Output The list of dishes not ordered in numerical order. If every dish sells, print the set of dishes that were ordered least. Separate each number with a new line. 41. (a) 1. (a) 1 A) Design an algorithm that inputs two lists of numbers, A, and B, of lengths n and m respectively, and finds out (and prints) how many common elements they contain. For example, if A contains 104, 195, 26, 503, 404, 793, 39, 995 and B contains 612, 27, 39, 321, 104 the algorithm will output 2 (because 39 and 104 are common to both lists). B) What is the efficiency of your algorithm in terms of m and n? Please use really simple worded pseudocodeplease code in python Forbidden concepts: arrays/lists (data structures), recursion, custom classes Watch this video on the Fibonacci sequence. The first two numbers of the sequence are 1 and 1. The subsequent numbers are the sum of the previous two numbers. Create a loop that calculates the Fibonacci sequence of the first 25 numbers and prints each one.Lastly, state the 25th and 24th sequence in a sentence, and explain how the golden ratio is conducted from it, including what it is.Note: you don’t know what the 24th and 25th numbers are, get the program to find out and calculate itself what the ratio is.