Question
Asked Feb 10, 2020
2 views

Explain microcirculation 

check_circle

Expert Answer

Step 1

Microcirculation is defined as the blood flow through the smallest vessels present in the circulatory system. The smallest vessels are arteries, capillaries, venules and shunts. It also includes lymphatic capillaries and collecting ducts. The vessels involved in microcirculation are lined by flattened cells of endothelium which are surrounded by the contractile cells called pericytes. Microcirculation happens in all tissues and organs except the cornea of the eye.

Step 2

The structure of microcirculation has three components: pre capillary, capillary and post capillary. The function of pre capillary sector is the regulation of blood flow and this is done by the contraction and relaxation of smooth muscles. The seco...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.

Related Biology Q&A

Find answers to questions asked by student like you
Show more Q&A
add
question_answer

Q: Now imagine if you removed one hydrogen from methane and added a second carbon and its associated hy...

A: Click to see the answer

question_answer

Q: Does not need to be a super indepth answer. Explain the concept of the following realated to muscles...

A: Excitation–contraction coupling (ECC) is the physiological process in which a series of events conve...

question_answer

Q: these are the other sub-parts to be solved I really need a good explanation for these questions 8.Li...

A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering only the fir...

question_answer

Q: One of our homework questions in Anatomy 1 states Describe the relationship between homeostatic imb...

A: The term homeostasis is from the Greek words “homeo” meaning similar and “stasis” meaning stable. It...

question_answer

Q: Which of the following groupings of the abdominoplevic regions in medial ?  a. Hypochondriac, hypoga...

A: The abdominopelvic region is the cavity present beneath the diaphragm and houses parts of the digest...

question_answer

Q: What are the cells that are specialized to store triglycerides?

A: A triglyceride is also known as fat that consists of three long hydrocarbon chains called fatty acid...

question_answer

Q: пgусетае mez i9owss2 to yliznsb 9di 11.Which of the following devices will allow measurement of a li...

A: Accuracy is a measure closest to the true value. Precision is a measure that shows how close the rep...

question_answer

Q: all are correct about energy except    the biological world gets ots energy from the sun     chemica...

A: Energy is the capacity for vigorous activity. It may exist in various forms namely, kinetic, potenti...

question_answer

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant....

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’A...