Explain the advantage that populations of sexually reproducing organisms have over asexually reproducing organisms?

Q: GenAlex Medical, a leading manufacturer of medical laboratory equipment, is designing a new…

A: Introduction  The immune system uses antibodies, often referred to as immunoglobulins, to recognise…

Q: Question 5. One of the changes that happened during the study period was that there was less food…

A: Evolution is described as a time-consuming and complicated process of development. Evolution is a…

Q: During stroke volume, the pressure in the ventricles forces AV and semi-lunar valves open True False…

A: Stroke volume the volume of blood pumped out of the left ventricle of the heart during each systolic…

Q: Here is a third pair of lists, dealing w A. Bipedal locomotion B. Complete postorbital septum C.…

A: Evolution can be described as a slow process of change in the heritable characters. The organisms…

Q: One study predicted that trained subjects would have a resting metabolic rate 100-200 kcal/day…

A: The energy spent when a body performs basic functions which are required to stay alive is basal…

Q: 4. There are two principles underlying gel electrophoresis: charge, and the use of a gel matrix.…

A: As per our guidelines we are supposed to answer only ? One question ( if there are multiple…

Q: what is bone marrow as an hematopoietic organ

A: Mesenchymal and hematopoietic stem cells are found in bone marrow. Red bone marrow is a fragile,…

Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…

A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…

Q: Why is it said that photosynthesis and cellular respiration are reverse chemical processes?

A: Photosynthesis :-it is the process of production of food (oxygen and glucose) in the plants by using…

Q: Identify the cell organelles labeled in these actual TEMs of human cells; list them on the lines…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: Step 1: Depict E + S • Draw an enzyme and one substrate. Show and label the substrate binding site…

A: Enzyme It is a protein molecules which is used in a biological reactions and lower down the…

Q: Answer the given situation below; a. Bob says that he is healthy and has no genetic diseases such as…

A: Introduction: Genes are a set of instructions that determine what the organism is like, its…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Introduction  :  A membrane that permits certain molecules to pass through it but not others is said…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A:

Q: Glucose is taken up by red blood cells by binding to a specific pocket in a membrane protein which…

A: The study of chemical reactions that take place within and relate to live beings is known as…

Q: A. Drawing of Cell in Distilled Water Mount: (with Label) H₂₂0 H₂O H₂O H₂0 Drawing of Cell in Normal…

A: Figure A is of  The cell is in isotonic solution.  The flow of water is from both the side until…

Q: Put the following in order in mitosis and the preceding interphase Hint: Determine whether the event…

A: In eukaryotes, Cells divide either via mitosis or meiosis. Somatic cells divide via mitosis.…

Q: Describe the fluid compartments (ICF, ECF, blood and interstitial fluid) Describe the distribution…

A:

Q: Where is the energy stored in a molecule of ATP?     In adenine     In the bonds between the…

A: ATP is the energy currency in the cell.It is chiefly synthesised in the mitochondrion of the…

Q: DNA: What supercoiling is, how and why it occurs, and the differences between positive and negative…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: a) Use this data, and sketch a graph by hand that would best fit the data. (think which type of…

A: Aurelia  Aurelia commonly known as jellyfish because of its jelly like materials from which it is…

Q: Fill-in 1. A___ is a glass or plastic rectangle on which specimens are mounted. 2. A _?__ is at the…

A: Microscope is an instrument by which we can seen the large images of small specimen.

Q: What kind of response is seen via temperature stress in Drosophila? Are these kinds of elements…

A: The physiology of organisms, especially ectotherms, is significantly influenced by temperature,…

Q: to facilitate movement of ions and molecules across membranes. to move food, water, and wastes…

A: The cellular membrane is partially permeable and controls the movement of substances into and out of…

Q: Algae and other phytoplankton are not abundant in aquatic communities. Species with identical niches…

A: Van Valen gave an explanation for his hypothesis as a manifestation of an evolutionary strategy. He…

Q: Parathyroid hormone and calcitonin are hormones that work antagonistically. Two other hormones that…

A: Introduction :  Chemicals called hormones serve as the body's primary messengers. The endocrine…

Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…

A: Membrane transport is the collection of mechanisms that allows the solute molecules to move in and…

Q: Choose one of the following scenarios. Describe the scenario. Describe the chain of events terms of…

A: Tonicity  It is the capability of cell to loose of gain water of the cell. The movement of water…

Q: Calculate ΔGinward. Is energy required for transport to happen?  The cell is at 25°C. Membrane…

A: Energy is required in cases where there is active transport of molecules as molecules are…

Q: Tetracyclines are a class of prokaryotic antibiotic that ?

A: Tetracyclines are bacteriostatic and broad spectrum antibiotics that destroy specific…

Q: The body/mass index (BMI) uses ____ to assess weight range. a. Waist circumference b. Height and…

A: Body mass index (BMI) measures body size. It is determined by knowing the weight in kilograms and…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: Introduction Inheritance patterns are of different type’s   Mendelian inheritance, incomplete…

Q: The is morphological difference between bipolar neurons and unipolar neurons and that determines how…

A: As you are reading this book, think about the organs that are functioning within you right now! Your…

Q: Clearly draw the Punnett Square A woman carrier an allele for baldness (XbXb) marries a man who is…

A:

Q: Which three proteins participate in movement of vesicles from the plasma membrane toward the…

A: Transport of macromolecules through vesicles:-  large molecules usually internalised by plasma…

Q: O SCH₂ H OH H OH W W and Z X and Z W and X X and Y NH₂ W and Y O 1 CH₂ H OH H These are purine…

A: DNA is a genetic material in most of the organism which is composed of various nucleotide base join…

Q: Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on…

A: Lipoproteins like LDL (low density lipoprotein) and HDL (high density lipoprotein) are transported…

Q: Which of the following occurs when red blood cells are transferred from an isotonic solution to a…

A: Many biological subdisciplines exist within cell biology. An illustration of this would be studying…

Q: Which species is the better interspecific competitor: Lemna polyrhiza O Lemna gibba O Lemna…

A: Introduction  When individuals of different species fight for the same resources in an environment,…

Q: Name the physiological systems used to control the function of physically distant organs/tissues?…

A: Physiological system It is the system of our body that performs the major work like digestion,…

Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…

A: Given,  Blood group of mother = O Blood group of father = A

Q: 4. What is a peptide bond? Label the peptide bond in the figure. 5. Draw the skeletal structure of…

A: Polypeptide chain The polypeptide chain is the chain of protein which is made up of amino acids.

Q: Explain the hydraulic limitation hypothesis and what it says about tree height.

A: The word "hydraulic" relates to the "movement of liquid". Hydraulic Limitation Hypothesis is a…

Q: In humans, when iodine levels are adequate, abnormally high TSH secretion would likely result in…

A: Hormones are chemical substances that are secreted by various glands inside the body upon receiving…

Q: what is the decimal reduction time?

A: D-value or the Decimal reduction rate is the required time to achieve 90% killing/ reduction of…

Q: Due to climate change, food security is highly compromised. Sequentially explain recombinant DNA…

A: Introduction :  The use of technology to alter or manipulate a biological system for human advantage…

Q: Which of the following F2 phenotypic ratios show codominance? Assume you are starting with a…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: NOT TRUE about membrane transport?

A: Option c is the right answer. Membrane transport did not get of duplicated organelles in a cell.

Q: Based on the information in the following table, and the given phylogenetic tree, what kind of…

A: Classification It is the branch of biology that deals with the nomenclature, identification, and…

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.