The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides,whereas the length of the MRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference? Explain in detail.For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).AIxBIUSParagraphArial14px

Central dogma is the process in which DNA is transcribed in to mRNA is called transcription and mRNA…

Answered: F10 (PC) or ALT+FN+F10 (Mac). Paragraph…

Science

Biology

F10 (PC) or ALT+FN+F10 (Mac). Paragraph Arial 14px

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: First letter U U UUU UCU UAU UGU UUC UCC Tyr Cys UAC UGC UUA UCA UAA STOP UUG UCG UAG STOP UGA STOP…

A: Introduction Gene expression is the process through which information from a gene is used to create…

Q: Ending ridge, bifurcation, dot, and island are exmaples of some of the characteristics used in…

A: Fingerprints are unique individual characteristics which vary from person to person. No two…

Q: boy is colorblind

A: Color blindness is a inherited diseases that is it is transferred from parents to their offspring.

Q: are dit View Insert Format Tools Table

A: Parenchyma cells are one of the most common cells found in plants that presents in most of its part…

Q: Write on paper and use blue pen. Make a table please

A: 1) the First figure represented Option B carbohydrates which are naturally occurring compounds and…

Q: body { font-family: Georgia, serif; font-size: 100%; line-height: 175%; margin: 0 15% 0;…

A: Kindly retype your question

Q: ccu ccc cca ccg is a generic code

A: The genetic code is a system of triple letter codons that are made up of a combination of the…

Q: Remaining Time: 43 minutes, 49 seconds. v Question Completion Status: What is the function of…

A: The given diagram is of an earthworm. An earthworm belongs to phylum Annelida, has a tubular shape…

Q: Is it possible to get this typed

A: Introduction Antibiotics are the compounds that are used specifically to target and kill bacteria or…

Q: * Fays CISD 6 Schoology hayscisd. schoology.com marks G Image result for fan.. Image result for…

A: Given: Each term with its description.

Q: First letter U C A U G Second letter UUU UCU Phe UGU UUC Cys UCC UGC UUA UCA UAA STOP UGA STOPA UUG…

A: Mutation is defined as any change in the sequence of a DNA, chromosome structure or the number of…

Q: Don't copy from Google. Exaplin also

A: The correct answer of the given option is b. The Wharton duct which is also known by the…

Q: Letter 'B' corresponds to

A: This is the Potential Energy Diagram for a reaction. It is used to predict whether the reaction is…

Q: Please answer fast A scientist used the identifiler PCR kit on a sample from crime scene. He got…

A: Forensic Scientist got no amplification in case of negative control here. So, the PCR stock is good…

Q: RL/rl × rl/rl do the punnett square for this cross

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Please draw the figure with all the figure's visas by hand Note: The drawing should look like a…

A: The plasma membrane of a cell has a phospholipid bilayer, it has protein in the form of integral…

Q: on't copy from Google

A: Let us first discuss the location of each gland and hence it will lead us to the location. Parotid…

Q: Please unscramble the letters to discover them. 1. pgyocntei ernviaca 2. lpomcohailgro…

A: 1. pgyocntei ernviaca - genotypic variance 2.lpomcohailgro niaovrait - morphological variation…

Q: talk about Von willebrand factor test

A: Platelets are also called as thrombocytes and plays a vital role in hemostasis. There are several…

Q: In tabular form, differentiate the sequence for donning and doffing of personal protective…

A: Personal protective equipment commonly known as PPE, serves as an important measure to reduce the…

Q: Fill in the blanks to complete the given statements. Choose from the words inside the box and write…

A: Introduction: It is very necessary to maintain an aseptic environment before performing any…

Q: Your client developed philibitis. Write two nursing considerations to manage this I.V. Complication.…

A: Phlebitis is also known as vein inflammation in which the vein is inflamed with or without a blood…

Q: write the full form of LINEs

A: The transposons are the segments of genes that are capable of moving from one position to another…

Q: Is this a successful streak plate? What mistake do you think was made in the image? Thank you.

A: Answer. No, this not a successful streak plate. From the picture above it seems that you want to do…

Q: I letters

A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…

Q: ck istock iStock iSto Images by Getty Images" by Getty Images by Getty iStock iStock iStock by Getty…

A: The living, self-reproducing, structural and functional unit of all living organisms is called…

Q: А Photo by MJTPanganihan Photo by MJTPanganiban Color: Color: Form: Form: Margin:

A: A growth medium is intended to promote the growth of a variety of microorganisms or cells by the…

Q: X009

A: The tissue labelled in X is Lamina Propia . Lamina Propia is a type of loose connective tissue which…

Q: What is unknow ID?

A: An unknown ID is the one where the identity of the person is hidden or non recognizable.

Q: What symbol does a header on a FASTA file start with? O O O

A: In bioinformatics as well as biochemistry, the FASTA file is considered a text-based format, which…

Q: 1 2 3 4 5 C сл 10 6 7 8

A: Respiratory system It is a set of organa that allows a person to breathe and exchange oxygen and…

Q: Correct answer

A: Tissues refer to the group of cells that performs specific functions associated with the region to…

Q: 011. LABEL COW EYE - click on the drawing to edit/add labels.

A: Answer: Introduction: The average radius of the cow eyeball is just over 1/2 inch (15mm) and…

Q: 32 bit laptop comp.. E- H-

A: Glands in the body are basically of two types :- A ) Exocrine gland B ) Endocrine gland Exocrine…

Q: А Photo by MJTPanganihan Photo by M-JTPanganihan Color: Color: Form: Form: Margin:

A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…

Q: Before and after for the image the color how is changed

A: Combustion is the chemical process that involves the reaction of a substance with oxygen resulting…

Q: Please select correct one

A: Cancer in simple term can be referred to a set of diseases which are caused by the production of an…

Q: AaBbCcDe AaBbCcDr AaBbC AaßbCct AaB AaBbccc Ao8bccD AabbCcD AaBbCcD AaBbCcDr AaBbCcD AabbCcD OFind U…

A: Biological macromolecules are important cellular structures. There are 4 major classes of…

Q: Write the correct letter in the space provided before each number.

A: Answer Infants and toddlers communication skill development depending on their parental interaction.…

Q: HgA HgB HgA HqB

A: Punnett square was named after Reginald C. Punnett. It is a diagram used to predict the genotypes of…

Q: Select one: O D C о в O B

A: Looking at the question, we need structure of AchE enzyme which has a phosphate group and two methyl…

Q: Label the parts using the wordbank.

Q: 38.Label the drawing:

A: Angiosperm plants have different parts. These are root, stem, leaves, flowers, fruits, and seeds.…

Q: Label the structure with x

A: The above given diagrams are of pig (image 1 dissection of pig).

Q: identify codes in the Medicine section (

A: Answer : Explanation :- 1. Code in the medicine section that could be located…

Q: Please fill out 1-3 if possible

A: 1 Action potential. 2 sodium and potassium channels

Q: Modified true or false. Write the correct answer if the underlined word is false.

A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…

Concept explainers

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.

Question

The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides,
whereas the length of the MRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference? Explain in detail.
For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).
A
Ix
BIUS
Paragraph
Arial
14px

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.…
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
You have assembled a new prokaryotic genome and are annotating the genes. If you were to search for highly conserved sequences necessary for normal gene expression, what type of annotation are you doing? Group of answer choices ad hoc annotation homology based annotation preliminary annotation ab initio annotation
Human wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?
In relation to central dogma of molecular biology answer the following questions: The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables, determine the complementary mRNA sequence for the five portions of the Mc1r gene provided. (Note: You are only transcribing short portions of the DNA sequence for this protein. The actual gene contains 954 base pairs.) Using the mRNA sequence completed, determine the resulting amino acid sequence of the MC1R protein. (Note: You are translating only a portion of protein. The full protein is 317 amino acids long. The numbers above the columns in the tables indicate amino acid positions in the protein sequence.) You may use the genetic code chart provided
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in immature red blood cells is a reliable indicator that more alpha hemoglobin protein will be made in those cells?
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?