Answer the given question with a proper explanation and step-by-step solution. Please answer correctly according to the question Write three C++ program (server.cpp, client.cpp) as described below:First program (server.cpp):1. Creates a shared memory segment for store three integers' numbers (number1, number2 andnumber3).2. Prompt the user to enter the three numbers number1, number2 and number3 in the sharedmemory.3. Print a message in new line "Program server: All numbers are in the server".Second program (client.cpp):1- Client will access the shared memory created by the server and should print the message"Program client:"2- The client program should check if the three numbers are prime or not. For each number,if the number is prime, show the message "The number is prime" and if the number is not prime,show the message "The number is not prime"Sample Input/output:Enter the first number = 25Enter the second number = 7Enter the third number = 12Program server: All numbers are in the server:Program clientThe first number 25 is not primeThe second number 7 is primeThe third number 12 is not prime

Name: Answer the given question with a proper explanation and step-by-step s
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: Answer the given question with a proper explanation and step-by-step solution. Please answer correctly according to the question Write three C++ program (server.cpp, client.cpp) as described below:First program (server.cpp):1. Creates a shared memory

In this problem, we are required to create two C++ programs: server.cpp and client.cpp. server.cpp…

Engineering

Computer Science

First program (server.cpp): 1. Creates a shared memory segment for store three integers' numbers (number1, number2 and number3). 2 Lauquena sagala 0039+04+ 20400 0420311 09+ +wong poacys 04+ ! Cauquan puc caoquana

First program (server.cpp): 1. Creates a shared memory segment for store three integers' numbers (number1, number2 and number3). 2 Lauquena sagala 0039+04+ 20400 0420311 09+ +wong poacys 04+ ! Cauquan puc caoquana

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Please write a c++ program that will take in a file, a number_of_bytes and number_of_threads. So it will take in 3 arguments in the command line. mmap the number_of_bytes of the given file into memory. The program will mmap 100 Megabyte of file into memory and use 4 threads to examine the bytes. The main will not participate in the computation, but will create the specified number of threads, and wait for them to complete the computation, and the main will then print the answer. At most 8 threads will be specified to be created. Each file will contain a long string of letters like DNA, i.e. a,c,g,t The program should determine how many 20-character substrings contain more than 11 a's. For example, in this string there are characters matches: tattataaagtagaaatataactgaaggttcagccgctggattataaagtagaaatataaaaagtagaaatataactgaa The program should output: total matches number # number is replaced by the correct number
Use C, C++, python or matlab to develop a program whose main routine accepts two parameters n and k, i.e. when you invoke your program from the shell, you pass it two parameters, n and k, where n >=16 and k >=3 and is in powers of 2 (e.g. 2, 4, 8, 16, etc.). Your main routine shall generate a random page trace of size n, where the page numbers have values ranging from 0 to ? − 1. Develop a subroutine within your program that implements the LRU page replacement algorithm (as a separate function within your program). Your algorithm shall use the doubly linked list stack implementation as outlined in slide 29 of lecture 10). The function shall accept a page trace and a parameter f for the number of frames allocated. Your main routine shall then apply the random page trace to the subroutine implementing the page replacement algorithm, multiple times (using only one trace, randomly generated), passing a parameter f (number of page frames used) that ranges from 4 to k. Your main…
Use C, C++, python or matlab to develop a program whose main routine accepts two parameters n and k, i.e. when you invoke your program from the shell, you pass it two parameters, n and k, where n >=16 and k >=8and is in powers of 2 (e.g. 8, 16, 32, etc.). Your main routine shall generate a random page trace of length n, where the page numbers have values ranging from 0 to ? − 1. Develop a subroutine within your program that implements the FIFO page replacement algorithm (as a separate function within your program). The function shall accept a page trace and a parameter f for the number of frames allocated. Your main routine shall then apply the random page trace to the subroutine implementing the page replacement algorithm, multiple times (using only one trace, randomly generated), passing a parameter f (number of page frames used) that ranges from 4 to k. Your main routine shall then record the number of page faults for each run (i.e. for each f).Run your program using a page…
This is concerning files in c/c++ If I wanted to do the equivalent of a command-line rm followed by touch with one C function call, what would that be? Assume that pathToCleanse holds the path to that file
My task from the teacher is to create a program that solves the three problems using threads in Python: I start a little bit with it but I don't know how to complete it. In the readers-writers problem there is a common resource where a group of actors called readers want to read from the resource and another group of actors called writers want to write to the resource. The basic synchronization problem that needs to be solved is:1. Mutual exclusion of the resource, where:• only one writer may print at a time, and• no writer may write while a reader is reading.An ordinary mutex lock that is applied equally to all actors can solve this but will lead to only one actor being able to enter its critical section at a time. The next problem that needs to be solved is therefore the following: 2. Several readers should be able to read the resource at the same time. The last problem that needs to be solved is therefore the following: 3. As soon as a writer wants to write, new readers must not…
The following question is related to Threading in C programming Task-3: Write a program in c that has a function that takes the name of the user and adds all the ASCII value of the characters and returns it. Now create 3 threads that run the function using 3 different user names. Now print “Youreka” if all the returned values are equal, print “Miracle” if the 2 returned values are equal, and print “Hasta la vista” if the values don’t match using another thread.
Modify the attached c++ program on computerized telephone directory by adding an address. As the user enters the name, the telephone number and address will also display.
Implement a Socket based Remote C compiler. NEED THE PROGRAM IN JAVA. The JAVA program will take a C program (from a txt file) as input, send it to the server to compile & execute it, and return it to the client. In other words,The client will write or chose a C program which will be copied to the server, compiled and executed in the server machine and return the result back to the client.
Hello, I am practicing code in my Python book and I am struggling to define the submit and clear buttons for this Address Entry Form. It isn't working and states that they aren't defined. I also cannot get the 'sunken' effect look on the window frame. Can you help? My code is below. # Import tkinter import tkinter as tk # Define the submit button with a function def submit(): print("First Name: %s\nLast Name: %s\nAddress Line 1: %s\nAddress Line 2: %s\nCity: %s\nState/Province: %s\nCountry: %s" % (e1.get(), e2.get(), e3.get(), e4.get(), e5.get(), e6.get(), e7.get())) # Define the clear button with a function def clear(): e1.delete(0, 'end') e2.delete(0, 'end') e3.delete(0, 'end') e4.delete(0, 'end') e5.delete(0, 'end') e6.delete(0, 'end') e7.delete(0, 'end') # Create the master title master = tk.Tk()master.title("Address Entry Form") # Create the 'sunken' look for the window frame sunken_frame = tk.Frame(master, relief=tk.SUNKEN) # Create the labels…
Write a C program that takes one ore more file or directory names as command line input and reports to the terminal: file type, number of links, permissions, time of last access, etc.
Write a function-based C++ program that reads a c-string from a file (input.txt) and an integer key from the console. Your program should encrypt the string by adding the key value to all its alphabets. Make sure that if adding the key value makes the alphabet go past the letter ‘Z’ or ‘z’, you must rollover and start over from ‘A’ or ‘a’ respectively. All other non-alphabetic characters should remain the same. Write the encrypted string into an output file (output.txt). Example 1: Input File Aliens on Earth! Enter a key: 1 Output File Bmjfot po Fbsui! Example 2: Input File Welcome to Xiwan restaurant XYZ. Enter a key: 5 Output File Bjqhtrj yt Cnbfsl wjxyfzwfsy CDE.
Write a C program that has a function that takes the name of the user and adds all the ASCII value of the characters and returns it. Now create 3 threads that run the function using 3 different user names. Now print “Youreka” if all the returned values are equal, print “Miracle” if the 2 returned values are equal and print “Hasta la vista” if the values don’t match using another thread.