For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5' end G CUC G GAGC GCGGAUUU CCRO 11 C15 3' end GACAC CUGUG 11 GAA anticodon U anticodon loop G 2
Q: What is a realized niche? O The environmental conditions in which a species can live. O The…
A: Introduction: Ecology studies the interactions between living things and the settings in which they…
Q: Match the following: Gastrulation Organogenesis Blastula formation Formation of organs Gamete…
A: INTRODUCTION Gastrulation is a process in the early development of the embryo. The gastrula is…
Q: Which factor sets the lower limit of Balanus' realized range in the intertidal zone? O Ability to…
A: Introduction: Connel conducted his field study on Scotland's rocky seacoast, where the larger…
Q: Listen Tissue damage most likely is happening in which of the following items? Laser light scattered…
A: Laser light can interact with tissues in four different ways: transmission, scatter, absorption, and…
Q: Interpret an evolutionary tree of a group of organisms.
A: The majority of contemporary categorization schemes, or phylogenies, are based on the evolutionary…
Q: How do you determine the polarity of a molecule?
A: Electronegativity is defined as the ability of molecules/compounds to attract electrons. Every atom…
Q: Answer the following questions: 1. What is the importance of capsule to a microoganism? 2. Why is…
A: Capsules are the outmost structures of bacterial and fungal cells.
Q: How does bulk transport of molecules governed in a eukaryotic cell?
A: Bulk transport mechanisms are required in cells to move large particles (or large quantities of…
Q: Energy and Enzymes If the following redox reaction occurred, which compounds would be oxidized?…
A: Just like animal cells, plant cells need oxygen and a way to get rid of carbon dioxide to continue…
Q: Answer the following 1. Why was Anton van Leeuwenhoek's discovery is important? 2. What is the…
A: Introduction: The natural world was finally explained by experiments and scientific observations…
Q: Which of the following reproductive isolating mechanisms prevents mating because the two species are…
A: The processes of reproductive isolation are a group of behavioural patterns, physiological…
Q: Which of the following subcellular structures facilitates intracellular transport?
A: The research of structure and function of cells is known as cell biology, and it is based on the…
Q: Use the image below to answer questions 2-3. As part of his series of experiments, Connell removed…
A: Competition When two species compete for the same thing like place, food, water, ect then this…
Q: The following is composed of a double stranded coiled helix: a. DNA b. RNA c. ATP d. A and B e. All…
A: Double stranded helix provide a secondary structure of a complex molecule. Helix also means that in…
Q: Create the Taxonomic Key below using the following arthropods Periplaneta americana Triatoma sp…
A: The key includes a chain of choices, primarily based totally on discovered functions of the plant…
Q: alapagos nes Between 1973 and 1978, the population of ground finches (a type of small bird) on the…
A: Answer In 1973,1) The maximum length for the beak of birds was…
Q: You make reaction progress curve by plotting absorbance vs time (seconds) and find the equation of…
A: LDH measurements are used in the daignosis abd treatment of luver diseases such as acute viral…
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A: Introduction: Substances travel through the cell membrane during cell transports.The cells allow the…
Q: Which species is the stronger competitor for space in the intertidal zone? O Chthamalus Balanus
A: Introduction The region between high and low tides where the ocean and land meet is known as the…
Q: Which species requires the least amount of nutrients in order to grow: Lemna polyrhiza or Lemna…
A: Introduction: Small monocotyledons termed Lemna polyrhiza and Lemna gibba float on the surface of…
Q: Question 15 Which of the following statements is TRUE of erythropoietin? O None of the above is true…
A: Erythropoietin is a hormone which stimulates the production and maintenance of red blood cells.
Q: F₁ generation 1. Parents with the following genotypes were crossed: RR x rr 2. Make a Punnett Square…
A: One of Gregor Mendel's great discoveries was the Principle Of Dominance. He noted that when he…
Q: The body/mass index (BMI) uses ____ to assess weight range. a. Waist circumference b. Height and…
A: Body mass index (BMI) measures body size. It is determined by knowing the weight in kilograms and…
Q: 13. Which of these statements concerning the symport of glucose into cells is true? Understand a.…
A: The process by which end products of carbohydrate digestion pass through the intestinal mucosa into…
Q: Minimize pipette handling Questions : How important is it to transfer the proper liquids in their…
A: Pipette is a safe method by which small amount of liquid can be transferred from one location to the…
Q: Using the oil immersion lens, you estimate 6 human cheek cells can fit across the diameter of the…
A: A microscope is an instrument used to identify and analyse minute objects . There are 4 different…
Q: (a) Determine the probable mode of inheritance for the trait shown in the affected individuals in…
A: A pedigree reveals the connections between family members and identifies the members of a family…
Q: A D F В 00 E G с Н
A:
Q: A. Epithelial Tissue 1. Tissue Type: 2. Identify the highlighted Structure. 3. Tissue Type: 4.…
A: Epithelium tissue Form continuous sheets(fit like tiles). Lack of blood vessels. Nourished by…
Q: 6. Today we amplified 150 ng of Bos taurus (calf) DNA by PCR. This amount of DNA contains about…
A: Given, Number of molecules of insulin gene in 150ng of Bos taurus DNA= 46324 molecules Number of…
Q: "The cuticle and its profound effect on the organisation and functioning of the insect body".…
A: Introduction : Insects belong to the class Hexapoda, or Insecta, which is the biggest division of…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: Introduction The term "membrane transport" refers to a group of systems that control the movement…
Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…
A:
Q: 1. A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The…
A: The restriction endonucleus are specific enzymes that are responsible for cutting phosphoruster bond…
Q: Draw two cells under high magnification in the space below and label the cell wall, nucleus and…
A: *Onion epidermal cells provides protective layer against viruses and fungi which may harm sensitive…
Q: (N + N) 2N N Match the correct stage to the correct ploidy 1. Sporophyte 2. Gametophyte 3.…
A: Introduction PLOIDY:- It is a total number of chromosome sets in somatic cells of the diploid phase…
Q: Two pea plants, each genotype TT, Tt Knowing that the allele of tall leg is T, allele short leg is…
A: Given Allele T - for tall t - for short T - dominant t - recessive Parent genotype and…
Q: Identify the type of division exhibited by the following: Binary fission Grasses Hydra Budding…
A: Reproduction The process of producing offspring. Reproduction make sure the life continues on earth.
Q: The following are the conditions that determines the direction of ions as it pass through the…
A: Introduction : A membrane that permits certain molecules to pass through it but not others is said…
Q: Does the removal of Chthamalus affect the distribution of Balanus? Yes No
A: Introduction: Connell carried out a number of studies in which he transferred the barnacles to…
Q: 1. Name the two body systems/organ systems that control homeostasis and identify which system deals…
A: We are allowed to do one question or upto three subpart of a question. Please repost the undone…
Q: Question 4. Now look at all the graphs. Which trait, beak length or wing length, has changed the…
A: Several processes contribute to evolutionary change. Natural selection, the differential success in…
Q: Using cable theory to describe axon conduction would tell us a. the larger the diameter of the axon…
A: In an ion cascades, action potentials move along neuronal axons. Transmembrane pathways near the…
Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…
A: Introduction : The four blood group types in the ABO system are A, B, AB, and O. These blood groups…
Q: Why are basic dyes more effective for staining bacteria than acidic dyes
A: Answer: Dyes are the colouring component which are used for many purposes like in microbiology for…
Q: Which of these activities, that results in energy expenditure, makes up the greater portion of…
A: Introduction In the body, energy is used in a variety of ways. To carry out vital tasks such…
Q: As you know, cells in our body are constantly dividing. What are the 3 ways that cells use to make…
A: A checkpoint is a stage in the eukaryotic cell cycle at which the cell examines internal and…
Q: As a physical therapist, you think that there is a good chance that aerobic exercise will improve…
A: A hypothesis can be proposed and tested using scientific procedures. The theories should be properly…
Q: A gene almost always codes for a ___________ and can be found at a specific place on a chromosome…
A: A gene almost always codes for proteins and can be found at a specific place on a chromosome called…
Q: Redraw and rearrange the branches of the tree below to make the most parsimonious (simplest) tree. A…
A:
Step by step
Solved in 2 steps
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.Please help me complete this solution, i cant figure out what is incoorect about this statement... is the Rrna nee to be repleced with Trna?From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
- A tRNA has an anticodon sequence 3′– GGU–5′. Identify the amino acidit is carrying?From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
- Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATAWhat's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUAUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
- Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand. tRNA UAA CCA UUA UAA mRNA Amino Acids AUU = isoleucine AAU = asparginine GGU = glycine GUC = valine GAG = glutamic acidmRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.