Answered: fragments will be formed-a, b, and c.…

fragments will be formed-a, b, and c. Which of the following gels produced by electrophoresis would represent the separation and identity of these fragments? a

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Related questions

Q: What is replica plating?

Q: Why does DNA moves towards anode in gel electrophoresis?

A: Gel electrophoresis is process that separates the molecule usually protein or DNA on the basis of…

Q: Alcohol is considered to be a significant reagent for the isolation of nucleicacids (RNA and DNA).…

A: In molecular biology, the extraction of nucleic acids DNA and RNA is the most crucial method. DNA,…

Q: Which of the chemical compounds below can be used to label DNA for flow cytometry?

A: DNA flow cytometry is a way to measure the amount of DNA in the cell. DNA flow cytometry is used to…

Q: In a gel electrophoresis, what do the lanes mean? Please desribe.

A: Gel electrophoresis is a procedure that is used for the separation of the DNA fragments based on…

Q: Name the technique used to separate fragments of DNA or mixtures of proteins?

A: The gel electrophoresis is a technique to separate DNA fragments and proteins based on their size,…

Q: Explain The replica plating technique?

A: Replica plating is used in the microbiological experiment. It helps in the testing of various…

Q: Explain how you would identify the separation of lysozyme from a mixed sample using electrophoresis.

A: Lysozyme : lysozyme is an enzyme found in tears, saliva, mucus, milk and other secretion of body.…

Q: Please answer the following using the experiment data below. Provide the formulas or methods used…

A: Transformation efficiency is defined as the number of colonies obtained per microgram of DNA plated.

Q: Fluorescence confocal microscopy (FCM) - STK38 monoclonal antibody (M01), clone 2G8- 1F3. 200 μm a.…

A: The STK38 Monoclonal Antibody from LifeSpan BioSciences is a Mouse Monoclonal antibody. This…

Q: Define about agarose gel electrophoresis ?

A: Electrophoresis is an important tool in biology. It involves separating basic biomolecules: nucleic…

Q: What are the importance of accurate wavelength measurement in purified DNA sample?

A: DNA is a double helical hereditary molecule. The nucleosome is a monomer of the DNA. In DNA, four…

Q: Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charged…

Q: What are the 5 steps of gel electrophoresis?

A: Gel electrophoresis is a method for separating DNA fragments (or other macromolecules like RNA and…

Q: What do you mean by polyacrylamide gel electrophoresis (PAGE) technique ?

A: To explain: To explain about polyacrylamide gel electrophoresis (PAGE) technique and its uses

Q: Explain two-dimensional gel electrophoresis in detail.

A: Proteins are the building blocks of life. Proteins are made up of amino acids. Amino acids when they…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it is 15 nucleotide long however on gels there are only 10 bands are present…

Q: What is the difference between SDS-PAGE and 2D electrophoresis

A: SDS-PAGE AND 2D electrophoresis- Both are isoelectric focusing mean also known simply as electro…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a mixed…

Q: During gel electrophoresis, in what direction (toward which electrode) does DNA move toward?…

A: There are different molecular biology tools and techniques used to analyze and quantify…

Q: In the alkaline plasmid screen, what two things separate plasmid from chromosomal DNAs?

A: Following is the procedure for the separation of plasmid by the alkaline lysis method.

Q: Which DNA fragment will be closest to the top (negative pole) of anelectrophoretic gel?a. 450 bp b.…

A: DNA can be measured in base pairs. We can consider base pair as basic unit of DNA. 1000 bp = 1 kb (…

Q: What are the bands seen below the marker in agarose gel electrophoresis?? Explain how these bands…

A: Introduction: Agarose gel electrophoresis is a widely used molecular biology technique for studying…

Q: Gel electrophoresis separates molecules based on size O charge O weight What is the restriction cut…

A: Gel electrophoresis is a technique by means of which the DNA molecules are separated on the basis of…

Q: t is the principle of gel electrophoresis?

A: The purity of isolated nucleic acids is determined using electrophoresis.

Q: The solid matrix that is usually used to attach the target DNA in southern blotting technique is…

A: Blotting is utilized in atomic science for the distinguishing proof of proteins and nucleic acids…

Q: What is the principle of the gel electrophoresis separation technique?

A: Biological techniques are procedures or strategies for studying biological things. Biological…

Q: If we have different protein samples. How would we analyze them using SDS- PAGE and 2-D gel…

A: Purification of proteins is a critical step in gaining a full understanding of the protein's…

Q: Using a 1 cm cuvette, the absorbance at 260nm of your double-stranded DNA sample is 0.15. What is…

A: The concentration of DNA in a sample can be estimated by different methods - absorbance (optical…

Q: What do you mean by amphoteric substance? Give examples of substance that is/are amphoteric. What is…

A: Answer 1. An amphoteric substance is a chemical species that, depending on reaction conditions, can…

Q: Explain the two-dimensional gel electrophoresis (2DGE) ?

A: Based on size and charge, macromolecules & their fragments can be separated and analysed using…

Q: Electrophoresis is an extremely useful procedure when applied to analysis of nucleic acids as it can…

A: Gel electrophoresis is a technique that separates the macromolecules based on their mass and charge.…

Q: constructing a map of the plasmid, pDiddy. What is the smallest fragment size that the…

A: Double digestion Restriction enzymes are eye enzymes that induce cuts(cleavage) at their specific…

Q: If the stop nucleotides were not added prior to loading the samples in the gel, what would the…

A: Gel electrophoresis is a molecular biology technique used to separate the fragments of nucleotide…

Q: The following image is of an agarose gel. If DNA samples were loaded to this gel and the…

A: Electrophoresis is a method that uses an electric field to separate macromolecules in a fluid or gel…

Q: The transformation results below were obtained with 10 ul of intact plasmid DNA at nine…

A: Transformation Transformation is the process by which exogenous DNA is transferred into the host…

Q: Discuss the use of gel electrophoresis for the separation of macromolecules (DNA, RNA and protein)…

A: In biotechnology the gel electrophoresis is routinely used technique that is used for the separation…

Q: What technique was used to photograph DNA in franklins famous photo #51? A- gamma ray photography B-…

A: Imaging with gamma rays is used in nuclear medicine, as well as in court medicine. This technique…

Q: why both ssDNA and RNA are single strands, but there is a difference in concentration

A: The absorbance of both the RNA and the DNA is measured at 260nm as well as at 280nm. The purity of…

Q: ibe What are the 5 steps of gel electrophoresis?

A: Gel electrophoresis is a technique for separating DNA fragments (and other macromolecules such as…

Q: in centrifugation, two proteins of similar density (ƿ=2.0) are separated at different speeds. What…

A: Centrifugation is used for the isolation of small quantities of particles or solids in the liquid…

Q: Choose the proper order for recombinant protein purification from bacterial cells. a.…

A: Recombinant proteins are a new combination of genes that forms DNA. It allows for the production of…

Q: What is gel electrophoresis?

A: All living systems are made up of chemical molecules, which interacts with each other to perform…

Question

24. A segment of DNA has two restriction sites-l and II. When incubated with restriction enzymes I and II, three
fragments will be formed-a, b, and c. Which of the following gels produced by electrophoresis would represent
the separation and identity of these fragments?
b
A
B.
a. A
b. В
с. С
d. D
е. Е
(+ w

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

27. You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1000 bp, respectively. After using the second enzyme, you recover 600-bp and 800-bp fragments. After treatment with both enzymes, fragments were 200, 400, and 800 bp. Draw the correct restriction map.
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?
What information and materials are needed to amplify region of DNA using PCR?
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
1. How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is SYBR green less toxic than EtBr? 3. What are the similarities and differences between Manual and Automated Sanger Sequencing? 4. What is the relationship between DNA fragment length and the distance it will run in a gel? (Restriction Enzyme Digestion)
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
2) Considering the technologies that pave the way for the identification of molecules on the basis of hybridization in the classical sense, within the scope of Recombinant DNA Technology; (20P) a) Which of these is used to identify which macromolecule,b) What do you understand in the context of hybridization and between which molecules there are technique-specificinteractions take placec) “Nylon membrane” or “nitrosdulose” commonly used in these technologieswhy "membranes" are needed,d) Explain how to design an application example for each technique you mentioned.
For each of the restriction enzymes listed below:(i) Approximately how many restriction fragmentswould result from digestion of the human genome(3 × 109bases) with the enzyme? (ii) Estimate theaverage size of the pieces of the human genomeproduced by digestion with the enzyme. (iii) Statewhether the fragments of human DNA produced bydigestion with the given restriction enzyme wouldhave sticky ends with a 5′ overhang, sticky endswith a 3′ overhang, or blunt ends. (iv) If the enzymeproduces sticky ends, would all the overhangs on allthe ends produced on all fragments of the humangenome with that enzyme be identical, or not? (Therecognition sequence on one strand for each enzymeis given in parentheses, with the 5′ end written atthe left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage.)a. Sau3A (^GATC)b. BamHI (G^GATCC)c. HpaII (C^CGG)d. SphI (GCATG^C)e. NaeI (GCC^GGC)f. BanI (G^GYRCC)g. BstYI…
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.