Give and explain each of a health promotion program or intervention about access of clean and safe drinking water of a community to avoid illnesses like diarrhea, typhoid and cholera. As a student, how will you implement it?

Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...

A: DNA is a basic hereditary molecule that carries information related to the person. 

Q: Chlamydia trachomatis is a sexually transmitted infection. The organism can be classified in differe...

A: Microbes may enter the body in a variety of ways and cause infection everywhere, but antigen and lym...

Q: Aedes aegypti and Aedes albopictus

A: Aedes aegypti was introduced 400–550 years ago from West Africa via European slave trade. Ships from...

Q: 4. d) mutation rate due to genetic drift

A: Answer  4. d) mutation rate due to genetic drift

Q: Which one of the following describes an epigenetic modification? O A point mutation in the coding se...

A: A methyl group bound to DNA inhibit transcription of gene.  This sentence denotes an epigenetic modi...

Q: A/an ________ operon is always on, while a/an _________ operon is usually expressed but can be turne...

A: Lac operan:In E.coli and other bacteria, the lac operon is a set of genes with a single promoter tha...

Q: Marfan Syndrome is a dominant trait inheritance in humans. It is a disorder that affects the connect...

A: ANSWER: Let us consider, M is the dominant gene and m is the recessive one. As marfan syndrome is th...

Q: In what ways are mitosis and meiosis different?

A: The fundamental and active biological process by which a parent cell, after replication of it's comp...

Q: How does methylation affect development in terms of epigenetics, cancer, and general development?

A: Answer :- Cancer cells contain adjusted DNA methylation designs. There is a lot of lessDNA methylati...

Q: Melting of _____ does not contribute to sea level rise   a. Greeland ice sheet   b. Antarctic ic...

A: Melting of ice leads to the increase in sea level. When the temperature increases, polar caps melt. ...

Q: What function do the cysteines serve in the structure of an opioid receptor? (think protein structur...

A: For instance, consider the general mechanism of binding of a ligand molecule to the receptor site. A...

Q: 2. What is the probability of having odd numbers using two die rolled at one time? A. 1/6 B. 1/3 C. ...

A: ANSWER 2) (D) 1/4 When two dice are thrown simultaneously probability of getting an odd number on bo...

Q: 5. Why do you think you feel tired and lethargic when you have a high fever?

A: Humans have evolved to develop body's responses and especially immune responses in such a way that k...

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...

Q: MOLECULAR CLONING • Molecular cloning is the laboratory process used to create recombinant DNA. • It...

A: Recombinant DNA: it is a method of combining two distinct DNA (molecule) sequences, which may or may...

Q: The last taxon you add should be the outgroup. You may need to redraw the tree when you are done to ...

A: Introduction :  In phyllogenetic study,  out group is the group that don't want to study.  In group ...

Q: Define single nucleotide polymorphism (SNP), restriction enzyme, cathode, anode, agarose, well, and ...

A: All these are components are used in gel electrophoresis  Gel electrophoresis is a technique in whic...

Q: (a) What is resource partitioning? (b) Fully describe an excellent example of resource partitioning.

A: A community consists of a population of different species.

Q: Question:- All the necessary ingredients for the Polymerase Chain Reaction (PCR) are mixed together ...

A: Uses of thermus aquaticus polymerase in PCR The main reasons that make Thermus aquaticus (Taq) perfe...

Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...

A: Answer : staphylococcus aureus appears golden yellow color because of the carotenoid pigments presen...

Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...

A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...

Q: Which is considered a true breeding plant? A. AABBcc B. AaBbCc C. AABBCc D. AaBBCC

A: The genotype of an organism is the genetic composition. The diploid organisms have two sets of chrom...

Q: Describe the specimen and explain how the presence of fossil bacteria supports the idea that the Ear...

A: Answer : specimen is the term used for the sample of anything which is used for testing and which te...

Q: Which of the following is NOT one of the methods used in identifying viruses in the laboratory? O a....

A: A virus is a tiny piece of genetic material, such as DNA or RNA, encased in a protein coat. A virus ...

Q: What are the stages of cellular respiration in which catabolism of sugars, glycerol, fatty acids, an...

A: Glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation are al...

Q: Define the following terms: Predator Prey Population

A: Introduction: Ecology is the branch of biology that deals with ecosystem (interaction between organi...

Q: In humans, wavy hair is a dominant trait and straight hair is recessive. 80% of the individuals in a...

A: The population which is ideal in nature is found in Hardy Weinberg equilibrium. The ideal population...

Q: Seven to nine testes in rows: * which is the following the crrect schistosomes     Schistosoma manso...

A: Schistosoma mansoni is a water borne blood parasite which belongs to the group of blood flukes gener...

Q: What is the difference between primary ecological succession and secondary ecological succession?

A: In this question we have to write the difference between primary ecological succession and secondary...

Q: QUESTION 1 Entamoeba histolytica is able to infect humans, moves using pseudopods, and is the most p...

A: Entamoeba histolytica was first discovered by Lambl in 1859 and its pathological nature was proved b...

Q: Give meanings for the following combining forms: 1. adenoid/o 6. nas/o 2. alveol/o 7. or/o 3. bronch...

A: Adenoid:- Glandular Alveolar:- Basic unit of functional existence of lungs bronho:- Related to bronc...

Q: Describe how you would experimentally demonstrate that a specific G beta protein subunit is required...

A: Cells communicate with each other via released proteins unique to each kind. Signal transduction pat...

Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to seque...

A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later assembl...

Q: Which of the following statements about the lac operon is correct? 1. lacZ, lacY and lacA proteins a...

A: Introduction :  Lac Operon -  Regulatory gene is Lac I . Structural genes are lacZ,  lacY and lacA. ...

Q: at are the types of hair

A:

Q: What do we use to try and understand the state (and quantity) of nature?   What are some challenges...

A: Definition Nature is defined as the natural Earth and the things on it, or the essence of a person o...

Q: What is the hurdle technology used to destry the microbial load in squash soup?

A: Squash soup is a liquid dish and it is present with High nutrients and low calorie i.e low carbs. An...

Q: If this is set to 100ul, what is the name of this micropipette? O p-2 O p-20 Op-200 p-1000 In two se...

A: An experiment is a process used in the scientific approach to test a hypothesis. The two most import...

Q: A pentapeptide was found to increase the rate of hydrolysis of fats in the adipose tissues to provid...

A: *Electrophoresis is a technique used to separate genetic materials like DNA and RNA and  protein bas...

Q: What are the advantages of storing food as fat rather than carb or protein? b) What is the formal de...

A: Introduction:- Vitamins and minerals are micronutrients that the body requires. These nutrients have...

Q: WHAT IS SNAIL IS CERCARIA OR METECERCARIA

A: Snail is CERCARIA What is CERCARIA?     Cercariae are the final intra molluscan larval stages that e...

Q: Q:-What is neoplasia?

A: Introduction In this question we will discuss about the Neoplasia.  

Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...

A: Introduction :- Escherichia coli (E. coli) is a type of bacteria that can be found in the environmen...

Q: What is ammensalim?

A: Introduction In this question we will write about the ammensalim.  

Q: If you are a strong taster, how many bands would you expect on the gel after electrophroesis? O1 O2 ...

A: Strong taster is the person who gets the taste of food stronger than average people they are called ...

Q: 21. What are two ways by which SARS-CoV-2 disguises itself from detection by its host-cell's immune ...

A: SARS CoV 2 is a RNA virus, members of large family of virus called corona virus. This virus mainly i...

Q: Which among the processes below will be used during heat defense? vasodilation and thermogenesis O s...

A: vasodilation work against heat as sweating does  When heat produce in body to balance the body tempe...

Q: Unpacking Problem 411. What type of organism is E. coli?2. What does a culture of E. coli look like?...

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...

Q: cite literature that predict an approximate shelf-life of a squash soup

A: Squash soup has a creamy texture and is made from a variety of squash species that not only have gre...

Q: Assume for simplicity that height is a discrete characteristic that is affected most strongly by a s...

A: Dutch populations have highest height in entire world. 

Health Promotion

Health promotion enables people to maintain a healthy body that will function properly, resulting in improved healthy and disease-free life. It includes public policies that address health-related factors, such as employment, working conditions, food security, housing, and income.