Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.

Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Give typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
Structural Stability of DNA True or false Hydrophobic bonding between stacked purine and pyrimidine Hydrogen bonding between purine and pyrimidine bases Hydrogen bonding between adjacent pyrimidine bases tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA
Give only typing answer with explanation and conclusion The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene The 23S rRNA The fMet-tRNA The 5S rRNA The 16S rRNA
BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Evaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines Both pentose nucleic acid and deoxypentose nucleic acid and deoxypentose nucleic acid Contain the same purines RNA contains cytosine and thymine DNA and RNA are hydrolysed by weak alkali The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA A given tRNA can be charged with only one particular amino acid
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. Use the table and write the sequence of the resulting peptide. Is it possible for a codon to code for another amino acid? What will be the effect if a mutation changes the codon UAU to UAA? What is a reading frame? If you are given a nucleotide sequence, how would you find Open Reading Frames? DISCUSS the reason why there are leading and lagging strands in replication?