HI Molecule 2 Molecule 3 Legend: Thick black line - RNA. Thin black line - DNA. Thin dashed line - DNA. Molecule 1

Q: The neighborhood of a lake has a population of snails, which come out onto the sidewalk when the…

A: The capture-recapture method also known as the Lincoln-Petersen Index is a statistical technique…

Q: The Petri Dish method is used in microbiology to raise bacteria in: a) rapid growth b) pure culture…

A: Petridish method is the growing or culturing the microorganisms in the petridish. It is easier to…

Q: An amino acid mutation in the voltage-gated sodium channel that caused the voltage gate helices to…

A: Amino acids are organic compounds that are the building blocks of proteins. They contain an amino…

Q: who invented Olaparib

A: A drug called olaparib is used to treat some cancers, specifically ovarian and breast cancers that…

Q: Based on what you learned in the Heredity and Inheritance Lab, complete a Punnett Square cross…

A: X linked recessive disorder is a kind of disorder where mutation occurs in one of the X chromosomes…

Q: Which one of the following concerning the genetically modified purple tomato is correct? It was…

A: GMO stands for genetically modified organism. It refers to any organism, such as plants, animals, or…

Q: Discuss at least 5 services provided by biodiversity. Discuss human influences on such services you…

A: Biodiversity refers to the variety of life on Earth, including the diversity of species, genes, and…

Q: The same molecular process that causes antigenic drift in HIV can lead to resistance to some…

A: ART stands for Antiretroviral Therapy. It is a combination of medications used to treat HIV (Human…

Q: Based on this picture answer the question: the family Enterobacteriaceae is represented by the and…

A: Bacteria are unicellular, microorganisms found everywhere on the planet, even in the harshest of…

Q: Terminator Transcription stops ||||| 5' Transcription continues Antiterminator 4. pt) Among the…

A: Riboswitches are genetic regulatory elements present in the non-coding regions of mRNA molecules…

Q: You are studying the diet of American bison. You gather the data in the graph below on the effort…

A: The heterotrophic organisms are unable to produce their own food and for this reason they depends on…

Q: If one did a research and the purpose was Identifaction of Fungal specifically Mushrooms Using…

A: If the purpose of the research was the identification of fungi, specifically mushrooms, using…

Q: Which of the following formulas are correct regarding productivity? (recall, GPP gross primary…

A: Gross primary productivity It is the total amount of carbon compounds produced by a plant in an…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: You isolate bacteria from several different pools at the recreation center. Curious about which…

A: BLAST are the tools that are used to identify the differences and similarities between the protein…

Q: 9. Answer all three parts of the following question: pists are... a. Explain how genetic drift can…

A: Evolution is a phenomenon that bring about alteration in life form from simple to more complex.…

Q: what are the Primary, secondary, tertiary and quaternary structures of Monoamine Oxidase B.

A: Proteins are macromolecules composed of repeating monomer units called "amino acids".These amino…

Q: 9. There is a negative correlation between the sleep patterns of owls and humans: owls are more…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: In order to discover the effects soils have on plant growth, three different soil samples will be…

A: A hypothesis is generally an explanatory statement that is used to predict the expected outcomes…

Q: How can the 4 nucleotides present in DNA code for the 20 different amino acids found in proteins?…

A: Adenine (A), thymine (T), guanine (G), and cytosine (C) are the four nucleotides found in DNA. These…

Q: Which of the following is the best definition of generation time in a bacterium? the time it takes…

A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…

Q: How do inactivated vaccines prevent disease? Briefly describe what an inactivated vaccine is and…

A: Inactivated vaccines are a type of vaccine that contain killed or inactivated microorganisms, such…

Q: what ribosome channels accept charged tRNA molecules?

A: Large macromolecular structures known as ribosomes are present in every live cell. They are…

Q: Question 4. RT-PCR differs from PCR because: a. The template used for amplification is RNA b. The…

A: RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) is a modification of the traditional PCR…

Q: Bile exits the gallbladder in the hepatic duct common bile duct cystic duct hepatopancreatic duct

A: A tiny organ beneath the liver called  gallbladder is essential to the functioning of the digestive…

Q: In an experiment that tested eye muscle reaction time based on a physical stimulus, 12 subjects were…

A: The amount of time it takes for the eye muscles to react to a visual stimulus is known as the eye…

Q: Calculate shannon- weiner index using this data

A: Shanon weiner index is a way to measure the diversity of species in a community. It is denoted as H,…

Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…

A: Mutations are changes that occur in the DNA sequence of an organism. They can arise spontaneously…

Q: PLEASE ANSWER THE QUESTION AND EXPLAIN SUCCINTLY IN 2 SENTENCES

A: The given question states some concerned data matching to be solved.  The black balls refers to…

Q: . Your RNA sample has an absorbance of 0.350 at A260. The dilution for this reading was 1:20. What…

A: The RNA concentration in a sample is measured using the absorbance of the diluted sample when UV…

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: what were some of the change over time that happen in whale science, identify the major discoveries…

A: The whale population define to the number of whales, which are big (larger) marine mammals belonging…

Q: Influenza virus is an RNA virus with a segmented genome whereas SARS-Cov-2, the cause of COVID19…

A: The influenza virus and SARS-CoV-2, the causative agent of COVID-19, are both RNA viruses, but they…

Q: TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATGG CAAT GACA AAUAAA M = H Universal START codon SE…

A: Codon is a three nucleotide sequence which together firm a unit of genetic code in a DNA or RNA…

Q: Part C Using the table as a guide, research and evaluate two forms of renewable energy. Use reliable…

A: Those sources of energy which are not based on the burning of fossil fuels are called renewable…

Q: Which of the following statements is NOT true of hormones? O All are organic molecules. All are…

A: A hormone is a chemical messenger produced by specialized cells or glands in the body that regulates…

Q: Which figure (A, B, or C below) corresponds to each of the following, where curves repre…

A: There are environmental factors that affect the chance of survival of organisms. These are called…

Q: Which genes is closest to tyr? Recipient Recipient leu- phe+ his-met+ tyr+ leu- phe+ his+ met- tyr+…

A: DNA is transferred from one bacterium to another during conjugation. DNA is transferred between…

Q: Label the figure to describe how DNA folds into a visible chromosome. Nucleosome Histones Centromere…

A: DNA (deoxyribonucleic acid) is the genetic material in most of the organisms. It is a double…

Q: 4. Can you explain why the predator and prey populations do not rise and fall together? What is the…

A: A healthy ecosystem needs predators to function properly. The population of prey is kept in check by…

Q: b. Suppose in 1,000 years the beetles from the sandy island come back into contact with the beetles…

A: Evolution is a naturally occurring phenomenon in nature by which all living forms tend to change by…

Q: Three corn seed traits are C for red, c for white; S for plump, s for shrunken; W for normal, w for…

A: To map the distances and order of the three loci (C, S, and W), we need to first calculate the…

Q: Question 9. RT-PCR represents an adaptation of PCR to the investigation of RNA. What enzyme is used…

A: A given DNA segment may be quickly multiplied (amplified) into a multitude of copies using the…

Q: explain the steps for restriction and how each procedure of these three routes is performed in…

A: In rabbits, restriction refers to the administration of a drug or substance through various routes…

Q: A genetics counselor, Nashaly Montez, notices an odd pattern in Devin’s pedigree, a propensity for…

A: Translation is a biological process that occurs in cells, during which the genetic information…

Q: The number of bacterial cells increases from X to 32,000,000 in 2 hr. The generation time is 20…

A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…

Q: A white blood cell has pathogen recognition proteins embedded in its plasma membrane. Initially, the…

A: White blood cells These cells are part of the immune system that are involved in fighting infection…

Q: When top-down control occurs within an intertidal zone along the rocky coastline of the Pacific…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: The holes in Swiss cheese are caused by Air pumped into the cheese during the aging process. Carbon…

A: Swiss cheese is a type of cheese that is known for its distinctive appearance, with large holes or…

Q: In terms of antigens and antibodies, explain why O- is considered a universal donor and why AB+ is…

A: All blood performs the same function but not all blood is created equal. Blood is divided into…

DNA and RNA

Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.

DNA as the Genetic Material

DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.

Genetics

The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.      

DNA Replication

The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.