How is polymerase chain reaction used as a diagnostic test for COVID-19? PCR serves as a molecular test to detect the SARS-CoV-2 virus's genetic material. PCR serves as an antigen test that detect specific proteins from the virus PCR is used to kill the SARS-CoV-2 virus in a patient's sample. PCR is used to quantify specific proteins in the SARS-CoV-2 virus.

How is polymerase chain reaction used as a diagnostic test for COVID-19? PCR serves as a molecular test to detect the SARS-CoV-2 virus's genetic material. PCR serves as an antigen test that detect specific proteins from the virus PCR is used to kill the SARS-CoV-2 virus in a patient's sample. PCR is used to quantify specific proteins in the SARS-CoV-2 virus.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Similar questions

With the aid of diagrams, explain how the polymerase chain reaction (PCR) can be used for detection of SARS-CoV-2 virus
Explain how PCR/OLA (polymerase chain reaction/oligonucleotide ligation assay) can be used in the diagnosis of sickle cell disorder . Would you recommend this method for routine diagnosis of sickle cell disorder? Explain
In the article "Sherlock: nucleic acid detection with CRISPR nucleases" by Max Kellner et al. (2020)Sherlock protocol (2).pdf Actions, authors explain in detail how CRISPR technology can be used to detect if a person is infected with SARS-CoV-2. In lecture, we mainly talked about CRISPR Cas9 but more Cas proteins have developed/discovered. Watch the following video that explain in more detail how Sherlock uses CRISPR technology to detect disease Which of the following statements are true:
The strain of λ phage t is cI857. That tells you that the cI DNA segment is disabled by a specific mutation. What is the exact genetic change in cI857? What specific property of the cI gene product does this mutation change, and how does this help titering for a plaque assay?
A urine sample has been obtained, and the bacteria in this sample were cultured. To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format): > sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…
Why not just inject the double-stranded cDNA that codes for the spike protein of the virus? What additional step or steps would you need to use to get the human muscle cells to produce the spike protein if the cDNA was injected to serve as the virus? The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein?
One improvement of CRISPR-Cas9 technology over the classical recombinant DNA technology is its ability to target specific sequences of DNA True False
) A citizen has posted the following on the Department’s social media page: “I see that my government has wasted my money on COVID-19 tests that give the wrong results, and I am going to pay double with forced isolation even when I am not sick. You paid big money for COVID-19 tests from the Beijing Genomics Institure (BGI) that give false positives. Your own scientists figured out (after the tests were approved) that the BGI tests give false positives but the reference tests do not. If I get a false positive result I have to be isolated from everyone—I miss work, can’t pick the kids up from school, and can’t meet that special someone at the local coffee shop—even though there is nothing wrong with me. I thought tests were supposed to give the right answers. Why did you spend my money on these tests that are worse than useless?” Write a brief (three to five sentences) reply that explains the nature of binary classification tests, and your interpretation of the results of the post-market…
Which of the following statements about Hfr strains of E. coli is FALSE? Group of answer choices Hfr stands for "high frequency recombination" In Hfr strains, the F factor is integrated into the main bacterial chromosome The location and order of genes along the chromosome can be mapped using the time of transfer of different marker genes. Genetic exchange between Hfr and F− strains is studied using the interrupted mating technique In Hfr strains, the F factor is integrated into a plasmid
During the adenoviral SARS-CoV2 vaccine development process, the plasmid encoding the Spike protein is generated. Elaborate on the steps you would follow to generate a recombinant plasmid encoding the Spike protein.
PCR primers are designed to only replicate the N gene sequence of the viral genome. Part of the N sequence we want to amplify is shown below. Typically, you design two primers, one to bind to each strand of the dsDNA. Copies are made from each strand so you get twice as much DNA from the PCR process. Potential primer locations are noted by the nucleotide sequences shown below. The PCR needs to make copies of the nucleotides shown in the middle (“87 nucleotides”). Remember the direction that DNA polymerase synthesizes new DNA strands. Select the two locations for the primers to bind and then fill in the correct sequence below the DNA sequence shown. You should have selected one location on each strand. Indicate the direction that the DNA polymerase (Taq polymerase) will move after binding to the primers in the attached image
Which nucleic-acid based technique will detect norovirus? A. Fluorescent In Situ Hybridization (FISH) probes B. PCR with primers specific for the genome of this virus C. Terminal Restriction Fragment Length Polymorphism (T-RFLP) D. reverse transcription PCR with specific primers A patient's blood sample tests positive for the antigen to Vibrio cholerae. Which of the following interpretations is correct? A. This person has cholera. B. This person was exposed to any species of Vibrio. C. This person was exposed to V. cholerae recently. D. This person had cholera at some point in their lifetime.