I. A. Photosynthesis Review 1. Where (in the Z-scheme) is O2 generated? How? Why? 2. What molecule does the O2 come from? 3. What colors of light are most important for photosynthesis?
Q: Explain your answer in some depth and avoid just saying "It is A" or It is B. Defend your answer and…
A: Earth is full of geological differences. Different regions have their own distinct characteristics…
Q: Describe the structure of the cell membrane using the terms ‘phospholipid bilayer’ and ‘fluid mosaic…
A:
Q: In somatic cell nuclear transfer, the nucleus of a somatic cell is inserted into an enucleated egg.…
A: A somatic cell nucleus refers to a cell whose nucleus has a diploid set of chromosomes which means…
Q: Identify the muscles and mention their functions. A B C
A: Muscular system is specialised system which help in movement of body Muscular system involves --…
Q: Identify this organism by its phylum
A: Some unicellular organisms are believed to be the ancestors of animals. Protista is a group of…
Q: If you have a friend or family member working at a high risk of a silicosis exposure-related…
A: Workers who breathe in crystalline silica experience fibrotic nodules and damage around the…
Q: Examine Whether the statement, "The microbiomes from healthy humans are all very similar", is true…
A: Microbiomes are the collective genomes of numerous human microbiota species. More than 5x10 6…
Q: 64. The graph shows the pressure-volume relationship of the lung (solid curve) and chest wall…
A: The graph is showing the pressure- volume relationship of lung and chest wall.
Q: Can you check if my answers are correct? If not, could you help me with the right answers? My…
A: Introduction: As per our guidelines we are not allowed to answer more than 3 subpart at a time…
Q: a. b. C. Pedigree of a Family with Cystic Fibrosis d. I 1 2 3 4 Note: Cystic fibrosis in this family…
A: Pedigree analysis helps us understanding the mode of inheritance of a particular disease by…
Q: For the following problems, please choose from the following modes of inheritance: autosomal…
A: Pedigree analysis: The inheritance of genes from the parents to offspring is shown using a pedigree…
Q: make a methodology about parasitic crustaceans of farmed fish. Limit your words in 300.
A: Let's take the example of sea lice Sea lice abundance generally shows a decreasing curve in wild…
Q: On the off chance that the round window couldn't swell out with an expanded pressing factor in the…
A: Introduction One of the two openings from the middle ear to the inner ear is the round window. The…
Q: Explain your answer in some depth and avoid just saying "It is A" or It is B. Defend your answer and…
A: Different species concepts try to define species on the basis of certain characteristics. The major…
Q: Name the reproductive and non-reproductive parts of bread mould (Rhizopus).
A: Bread mould is a type of fungus that can grow on bread. The mould is made up of tiny spores that…
Q: Nondisjunction that results in abnormal number of chromosomes can occur during prophase I.…
A: Nondisjunction can occur when chromosomes fails to separate,during cell division.It causes…
Q: Pyruvate, a product of glucose metabolism Express your answer as a chemical equation. Identify all…
A: Glycolysis is the biochemical process, in which glucose is Oxidised to pyruvic acid without the…
Q: Describe one advantage and one disadvantage of ASEXUAL reproduction.
A: Paramecium, sometimes known as Paramoecium, is a genus of "ciliated unicellular protozoa." They live…
Q: about parasitic cruataceans of farmed fish
A: Parasites are small organisms that live on other organisms called "hosts" and depend on them for…
Q: The cell cycle is the ticking clock that sets the tempo of developmental processes, with…
A: Cell cycle is composed of events that are responsible for the step by step growth and cell division.…
Q: Where in a eukaryotic cell does the molecular product of transcription (Eukaryotic Transcription) go…
A: In a eukaryotic cell, transcription occurs in the nucleus, and translation occurs at ribosomes in…
Q: In many lizards, and all snakes, the tympanum is absent and the columella transmits vibrations…
A: Evolution is a naturally occurring constant process involving change that allows the adaptation of…
Q: What is a multifactorial trait? b. Give an example of a multifactorial trait and describe what…
A: Genetics, environmental influences, or a mixture of both can influence traits. Subjective traits,…
Q: The cross-over frequency between genes O and S is Select one: a. 31% b. 29% O O
A: Given that, the gene for normal leaf is M, tall plant is D, normal tomato is O and simple…
Q: How preformulation studies help to find the drug performance and the development of a dosage…
A: Preformulation studies are performed before formulating a new drug or drug formulations. in…
Q: f the tilt of Earth's axis were 33.5° instead of 23.5°, how might seasons be different than they are…
A: Note: Sorry, please note that as per the honor code we are allowed to author only the first one…
Q: P. boisei and H. habilis lived alongside one another in East Africa. What are their inferred foods?…
A: Paranthropus boisei is an australopithecine that lived in East Africa between 2.5 and 1.15 million…
Q: objectives of making marinating fish
A: Introduction - • Fish is marinated for one main purpose, that being to impart additional flavour…
Q: What is the correct function of the lymphatic capillaries? production of pre-B and pre-T cells…
A: Lymphatic capillaries These are very small, extracellular fluid-processing microvessels with thin…
Q: At least one example of how the endocrine system helps to maintain homeostasis in the body. Provide…
A: Please follow step 2 for detailed explanation.
Q: A 32-year-old woman comes to the office with her 2-year-old son, whom you have been treating for…
A: Spina bifida Spina Bifida is a defect in embryological development where the spinal cord is not…
Q: 1. What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in…
A: Introduction Pancreatic juice has a pH 8.7 and is secreted by pancreas into the duodenum. It…
Q: what is Taxol ? What does it Target in cancer cells ? (relate it to cell communication and cell…
A: Introduction : The term "cancer" refers to disorders in which abnormal cells proliferate…
Q: The process of crossing-over occurs during Prophase I of meiosis Prophase II of meiosis…
A: First question Meiosis is the type of cell division in which a diploid mother cell divides to form…
Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
A: The initial stage of gene expression, transcription, uses information from a gene to build a…
Q: make a 5 referrence about fermentation in APA format
A: 1. Elmer L., Gaden Jr. (1959). Fermentation process kinetics. Journal of biochemical and…
Q: When a pathogen (or its toxins) enters the blood, the infection can spread throughout the body. Such…
A:
Q: Describe the evolutionary history of snails (Molluscs). In which eon, era and period did the first…
A: The Arthropoda, whose members are referred to as molluscs or mollusks, make up the biggest phylum of…
Q: The coefficient of relatedness between you and your uncle on your dad's side is O 0.25 O 0.5 O 0.125…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: What is the probability that a mother with blood type O and a father with the genotype /Bi would…
A: ABO blood group is an example of multiple allele and codominance in which IA allele is responsible…
Q: Homologous chromosomes Meiosis Eggs Sperms Gametes Fertilization Zygote Dominant alleles Recessive…
A: Introduction A concept map is a conceptual diagram that represents the relationships between various…
Q: A Sheepherder rush to you, during one of your surveillance visit to a community, with a concern,…
A: Ruminating animals or Ruminants are the animals which feed on plant-based food, since they possess a…
Q: Say, I have two offspring of my own and also three nephews in Michigan who I have never interacted…
A: The total of an organism's direct (personal) and indirect fitness is known as inclusive fitness. A…
Q: Explain the reason why most proteins have less D-aspartate and elastin has increasing levels of D-…
A: Racemization is the process by which a pure mixture of enantiomers is completely transformed into a…
Q: Use the diagram on this website to label following on the chloroplast diagram.
A: Light-dependent reactions These reactions use light energy to make products of ATP and NADPH that…
Q: Elaborately define the major considerations in dosage form design with example?
A: Drug substances are rarely administered alone; instead, they are combined with one or more…
Q: Give examples of antibiotics, their mode of action, target microorganism, and classify where they…
A: antibiotic is a chemical compound that is toxic to other bacteria and is generated by a living…
Q: In the Mexican hairless breed of dog, the lack of hair corresponds to the H/h genotype. Normal dogs…
A: Alleles are the alternative versions of a gene located at a particular location in the chromosome.…
Plant bio
Step by step
Solved in 5 steps
- A. Explain the role of ATP in life process. B. Complete the following table by comparing and contrasting the light-dependent and light-independent reactions of photosynthesis. You may use the link below for reference. https://youtu.be/KfvYQgT2M-k Light- independent reactions Point of Light-dependent reactions Comparison 1. Raw materials 2. Part of the chloroplasts where they occur 3. Light requirements 4. Products 15. Ву-productsI. How Does Light Intensity Affect the Rate of Photosynthesis? Procedure: The purple slider can be used to change the light levels. You will count the number of bubbles at each level. The timer in the square box can be used to measure 30 seconds. Otherwise, a data is provided below for your reference. Light Intensity Number of Bubbles (30 0 sec) 40 45 50 20 | 25 15 11 18 24 31 36 42 47 50 10 30 35 7 c. Oxygen produced by the plant d. CO2 produced from photosynthesis 30. Based on the light test, as you increase the intensity of light, the rate of photosynthesis 29. What does the bubbles represent? a. CO2 consumed by the plant b. Photosynthesis occurred a. Increases b. Decreases c. Stays the Same d. None producedA. The C4 plant performs photosynthesis more efficiently than the C3 when the CO2 concentration is 600ppm or less. Provide one reason why the rate of photosynthesis doesn’t change for the C4 plant when the CO2 concentration increases above 400 ppm. B. Discuss what is happening in the C3 plant when the CO2 levels are below 50 ppm. Provide one reason why this does NOT happen to the C4 plant.
- Answers can be kept very simple and concise Photosynthesis: A) Is NADPH consumed during the light reactions or Calvin cycle? What is it’s energy used to do? Protons move across the thylakoid membrane in both directions during the light reactions of photosynthesis. B) When protons move in to the thylakoid, are they moving up or down their concentration gradient? (From low to high concentration or from high to low concentration?) C) Since protons are charged, they cannot freely diffuse across a plasma membrane. What protein(s) facilitate the transport of protons in to the thylakoid?d) In the presence of sunlight, an electrochemical gradient is generated between two of the spaces within the chloroplast. 1.Describe what happens when a photon of light energy hits a molecule of chlorophyl. 2. What is meant by the term electrochemical gradient? 3.What role does the photosynthetic electron transport chain play in the generation of the electrochemical gradient? 4. Two chemical reactions also contribute to the generation of the electrochemical gradient. What are the reactions, where do they occur, and why do these factors affect the gradient? 5. The electrochemical gradient can be utilised by ATP synthase to generate ATP - explain how the location and structure of ATP synthase enable it to perform this function. e) The light reactions of photosynthesis generate ATP and NADPH for use in the dark reactions (i.e., the Calvin cycle). Why are they needed?of the claSS. 1. How do plants acquire the starting reactants of photosynthesis (CO, and H,O)? What do plants do with the products of photosynthesis (O, and carbohydrates)? 2. A plant may be using more energy to fuel life processes (cell respiration) than it is taking in through photosynthesis either because its cell respiratory rate is elevated or because photosynthetic rate is diminished. a. What is one potential reason why a plant may be forced to elevate its cell respiratory rate? b. What is one potential reason for why a plant may experience diminished photosynthetic rates? 65 1161_Ch_12_M....pptx
- Topic: Photosynthesis Hi. I'm having trouble determining the answer to this question. I would like to say it would be Water and NADPH. However, I am not confident. Would you help me with this question? Thank you. Original Question: The chloroplast electron transport chain requires a continuous donation of electrons from ___________ , which are used ultimately to reduce a molecule of ___________ .choose letter pls 1. why is cyclic electron flow important in photosynthesis? a. generates greater amount of energy in simple but efficient pathway.b. allows the plants to conserve energy produced during photosynthesis.c. converts chemical energy from inorganic moleccules with less input of atp.d. allows the plants sensitive to light and living in low light environment to produce atp 2. which of the following does not occur during the light dependent reaction?a. photolysis of h2ob. realease of oxygenc. regeneration of co2 acceptord. phosphorylation of adp forming atpChoose 2 of the following terms: Z protein / ATP synthase / Photosystem II. What is the specific role of each of the following? Describe what and how the protein does its job. As well, explain the importance of each in the overall process of photosynthesis.
- 1. Is carbon dioxide essential for photosynthesis? Justify 2. What is the relationship between photosynthesis efficiency and light intensity? Justify 3. For equal quantities of photons, what is the increasing order of effectiveness (less effective to more effective) of blue, red, green and white light (combination of the three main wavelengths) on photosynthetic activity? JustifySolve the crossword puzzle. - for any clue that says (2 words) you need to include a space between the 2 words of your answer. Across 9.) the point in the Calvin Cycle where the products from the light reactions (ATP NADPH) are used 2 4. 11.) stacks of thylakoids 12.) The fluid matrix of a chloroplast where the thylakoids are embedded and the Calvin Cycle 7 10 11 Down 12 13 3.) Organisms that synthesizes complex organic compounds from simpler inorganic raw materials 14 5.) Accessory pigments found in chloroplasts, that absorb wavelengths of light not absorbed by chlorophyll; these pigments are responsible for 15 Finish Et C 8.43. Where do electrons from Photosystem I go after they get excited by light? Group of answer choices a. The high-energy electron travels down a short second leg of the electron transport chain. At the end of the chain, the electron is passed to NADP+ to make NADPH. b.They travel down a second electron transport chain and are donated to oxygen which then bonds to hydrogen ions to form water. c. The high-energy electron travels down a short second leg of the electron transport chain and they are donated to ADP, which is then converted to ATP. d. They remain excited and then they travel to Photosystem II where they get even more excited until they spontaneously combust.