I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A bank was robbed in broad daylight. The CCTV cameras were not working and the police ruled it out to be an inside job. While looking for pieces of evidence in the vault room, you found a strand of hair. As a forensic scientist, you know that this piece of evidence can be a key to solving a crime. The hair was placed in a sample bag and was sent to the lab for DNA amplification using polymerase chain reaction. You also gathered hair samples from the employees that are in the bank. The lab sent the DNA sequence of the hair found in the vault room. Located in Row A below is the DNA sequence of the hair found in the vault room. In Row 1, give the complementary base pair of the DNA sequence and transcribe the DNA strand into mRNA in Row 2, then, translate that strand into a polypeptide chain, identifying the codons in Row 3, the anti-codons in Row 4, and the amino acid sequence in Row 5. Use the Translation table provided as vour reference. Don't forget to give the directionality of all the sequences. A 5' CGCGGAGCCATGGCCGAGGTGTTGCGGACGCTGGCCGGAAAACCATGACGCGGAGCC 3' 1 2 4 Second letter U UCU UAU UUU) Phe UuC UGU UAC Tyr UAA Stop UGC UGA Cys UCC Ser UUA ) UUG Leu UCA Stop UCG UAG Stop UGG Trp CAU His CUU CCU CGU CUC C CUA СС CAC CGC Leu Pro Arg CAA Gin CCA CGA CUG CCG CAG CGG, AAU1 Asn AGU AGC Ser AUU ACU AUC lle ACC AAC A Thr AGA Arg AGG S AUA ACA AUG Met ACG GUU GCU GAU GGU GAC Asp GAA Glu GAG S GGC GUC Val GUA GCC Gly GGA Ala GCA GUG GCG GGG, The hair sample collected from each employee was also sequenced and the table below summarizes the amino acid sequence for each employee. Vallery Emerson 3' Met-Ala-Gln-Val-Leu-Arg-Thr-Leu-Ala-Gly-Phe- Pro-STOP 5' 5' Tyr- Arg- His- Gln- Asn- Ala- Cys- Asp- Arg- Pro- Lys- Gly- Thr- Ala- Pro- Arg 3' Ricky Joannah 3' Met-Ala-Glu-Val-Leu-Arg-Trp-Leu-Ala-Gly-Phe- Pro-STOP 5' 5' Met-Ala-Gln-Val-Leu-Arg-Thr-Leu-Ala-Gly-Phe- Pro-STOP 3' Donita Jessie 5' Tyr- Arg- His- Gln- Asp- Ala- Cys- Asp- Arg- Pro- Lys- Gln- Thr- Ala- Pro- Arg 3' 3' Tyr- Arg- His- Gln- Asn- Ala- Cys- Asp- Arg- Pro- Lys- Gly- Thr- Ala- Pro- Arg 5' Compare the amino acid sequence you obtained from the crime scene and the amino acid sequence of the employees. Who among the bank employees could be the bank robber? Why did you say so? Third letter UCAGUCAGUCAGUCAG First letter