In autosomal dominant disorders, the recurrence risk is ¾(75%) when one affected parent and one carrier parent produce an offspring . True or false
Q: What is the importance of plasma proteins?
A: Plasma, also known as blood plasma, is a light-yellowish or straw-coloured fluid of blood that helps…
Q: Hypothyroidism - DEFINITION - PREDISPOSING FACTORS - SIGN AND SYMPTOMS - ANATOMY AND…
A: Hypothyroidism (underactive thyroid) is a circumstance in which your thyroid gland would not produce…
Q: Rehabilitation robotics, to use robots as therapy aids instead of solely as Smart rehabilitation…
A: The question has asked about a short explanation of the main terms provided in the question which…
Q: Examine a two-gene cross that follows simple Mendelian inheritance of freckles and eyebrow shape…
A: Two-gene cross :-
Q: why was s1 nuclease used? b) where do you think the mutation is occurring, and whats the…
A: Transcription is the stage when the DNA is converted into RNA. During transcription elongation, the…
Q: Explain the answer using the concepts of protein inside the microorganisms cell wall etc
A: Disinfection is a process in which the micro organisms are reduced through the disinfectants on…
Q: Colony shape: round Colony margin: entire
A: bacterial colony is defined as a clump of genetically identical cells that have been derived from…
Q: . Can a missense mutation of proline to histidine bemade with a G • C → A • T transition-causing…
A: A missense mutation is a point mutation that occurs in a codon that codes for a different amino acid…
Q: Question 8. What method can be used to compare the transcriptomes of individual single cells?
A: Cell- the smallest unit which can live on its own and makes up all living tissues of the body. It…
Q: In human body, the digestion of protein begins in which of the following organs? 1. Liver 2. Mouth…
A: The correct option is stomach.
Q: Briefly explain the water absorption rate and time spent in the water absorption response (WR)…
A: Terrestrial amphibians take up water by abducting the hind limbs and pressing a specialized portion…
Q: Use two different colors to depict the unduplicated chromosomes of species C with larger chromosomes…
A: Carbohydrates, lipids, proteins, and nucleic acid are well stated that are supposed to be an example…
Q: Define oxygen dissociation curve. Can you suggest any reason for its sigmoidal pattern?
A: Oxygen dissociation curve shows the percentage staruration of haemoglobin at various partial…
Q: Explain the autoregulatory mechanism of GFR.
A: GFR stands for glomerular filteration rate is a first step in urine formation. In urine formation…
Q: Which among the following gland produces Insulin, the chief hormone in body for metabolizing sugar?…
A: Insulin helps blood sugar enter the body's cells so that it can be used for energy. Insulin also…
Q: Order the following extravasation-related events as they occur.…
A: The white blood cells are responsible for giving immunity to the body. Different types of WBCs are…
Q: What substance is produced by a microorganism that is capable of the growth of other microorganisms?…
A: Antibiotics are medications that are used to prevent and treat microbial infections. Antibiotic…
Q: Write short notes on the following: (a) Neural coordination (b) Forebrain
A: Introduction The nervous system is our body's command center and is the major controlling,…
Q: Describe the conditions that scientists think existed on early Earth.
A: Introduction The origin of life on earth can be traced back to 3.4 billion years ago and as we now…
Q: Explain the autoregulatory mechanism of GFR.
A: Introduction In this question we will explain the autoregulatory mechanism of GFR
Q: List a few examples of cellular work. e. Where does the energy to make ATP come from? It doesn't…
A: 4 a. Exothermic,catabolic,G <0 The sign of ΔG for a reaction that is exothermic (ΔH is -ve) and…
Q: In the buccal cavity of human being, digestion of which one of the following get started? 1. Protein…
A: The correct option is CARBOHYDRATES
Q: Which of the listed terms is described by: “All the chemical processes that take place in the…
A: Term used for all the chemical processes that takes place in organelles and cytoplasm of the body.
Q: Based on the journal article “Interpretation of the Tube Coagulase Test for Identification of…
A: The coagulase test works on the principle that a coagulase enzyme causes the plasma to clot through…
Q: 2,It is mentioned that although streptomycetes contain many molecules with antimicrobial activity,…
A: * Streptomycetes belongs to the genus Actinomycetota and family Streptomycetaceae. *Over 500…
Q: Discuss how the social environment contributes to the worldwide DALYS (disability-adjusted life…
A: Answer- Nutrition is the consumption of food to help the body boost immunity.It also promotes the…
Q: There are many immunotherapeutics now being used to immunomodulate recipients that are either fully…
A: Wellbeing and immunotoxicity appraisal of immunomodulatory monoclonal antibodies Most remedial…
Q: 19. Independent assortment of chromosomes is a result of which of the following processes? A) the…
A: As per Bartleby Guidelines experts are allowed to answer only 3 sub parts kindly post the other…
Q: Which of the following actions would best enable you to demonstrate that the results of an…
A: *steps in scientific method involves the following steps Observation Asking a question Forming an…
Q: Why do we call our heart myogenic?
A: Introduction In this question we will discuss why our heart is called myogenic.
Q: Which test is performed to evaluate bleeding disorders?
A: Bleeding disorders are a range of illnesses in which the body's blood coagulation mechanism fails.…
Q: Why is Abscisic acid also known as stress hormone?
A: Abscisic acid is referred to as a stress hormone because it causes a variety of responses in plants…
Q: The first cells were probably (a) photosynthetic (b) aerobes (c) anaerobes (d) a and b (e) a and c
A: The first photosynthetic bacteria appeared about 2 billion years ago and they are able to produce…
Q: What sorts of studies would we undertake in order to confirm that human mating behaviors are truly…
A:
Q: Question 1: Define the following: (a) Exocrine gland (b) Endocrine gland (c) Hormone
A: (a) Exocrine Glandular Glands Exocrine glands are glands that secrete secretions into ducts and are…
Q: Which of the following is likely to cause the kidney to change the reabsorption of water and/or…
A: Answer : The cause that kidney to change the reabsorption of water and/or NaCl are : a. Drinking…
Q: What is the importance of understanding the structures and functions of molecules involved in the…
A: By knowing and understanding the basics about cancer and following the recommended guidelines for…
Q: Explain what is diversity and how is this important in an ecosystem.
A: Biodiversity is defined as variability among living organisms, diversity within species, ecosystems,…
Q: 1. Refer to the figure. Which of the following statements is incorrect? 35 30 25 20 10 5 Visual…
A: Neurons are the structural and functional unit of brain and the nervous system. They receive signals…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Explain how primary urine is introduced into the Malpighiantubules of an insect.
A: Malpighian tubules are thin-walled, blind-ended tubes that arise from the junction of the midgut and…
Q: Write short notes on the following: (a) Neural coordination (b) Forebrain
A: (a) Neural Coordination is a term used to describe the coordination of neurons in the brain. In…
Q: Compare the prebiotic soup hypothesis with the iron–sulfur world hypothesis.
A: Both prebiotic soup hypothesis and iron sulphur world hypothesis were given by different scientists…
Q: Several set of terms are used to indicate the direction and positi describing the relative position…
A: Several set of terms are used to indicate the direction and position. Describing the relative…
Q: relevance of Staphylococcus aureus in food safety, hygiene, and sanitation
A: Staphylococcus aureus is a round-shaped gram-positive bacteria. It is found on the skin and the…
Q: Humans and chimpanzees share many common characteristics. How would you explain the similarities of…
A: *Evolution is the change in the characteristics of an organism for many generations based on natural…
Q: What would happen to the ATP yield of cellular respiration if: The inner membrane of the…
A: The cellular respiration involves breakdown of glucose and production of energy in the form of ATP.…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: What is the importance of plasma proteins?
A: Plasma proteins are a group of proteins that circulate in the blood and play an important role in…
Q: Which juice secreted by the organs in the alimentary canal plays an important role in the digestion…
A: Digestive system in human consists of Gi tract and the various glands which help in digestion and…
In autosomal dominant disorders, the recurrence risk is ¾(75%) when one affected parent and one carrier parent produce an offspring . True or false
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Mention any two autosomal genetic disorders with their symptoms.Tongue rolling is an autosomal dominant trait. What would be the phenotype of a person who is heterozygous for this trait?If a woman is heterozygous for neurofibromatosis (a dominant disorder) and produces with a homozygous normal man for the disorder, what are the chances that a child will have the disorder?
- Most autosomal recessive genetic disorders are expressed as ____________________. dominant disorders codominant loss-of-function gain-of-functionDescribe in words the likely transmission of an autosomal dominant disorder. Include details of the parent’s genotype and subsequent pattern and probability of inheritance of the single gene disorder for the offspring produced and provide an example of an autosomal dominant disorderHuntington's disease is characterized by late onset mental deterioration and is invariably fatal. It appears to be caused by an autosomal dominant gene. A man with Huntington's disease (heterozygous) marries a normal woman and they have 5 children. What risk does each child have of contracting the disease? Write the full punnett sqaure equation showing ALL steps used to achieve your answer.
- Huntington’s disease is a dominant disorder. Suppose that Kent and Alice are both heterozygous for the disease. What is the probability that their children will have Huntington’s disease? a. None b. 25% c. 50% d. 75% e. 100%A woman with Huntington’s disease (autosomal dominant trait, and she is heterozygous) has children with a healthy man. What proportion of their children will inherit Huntington’s disease?If both parents have an autosomal dominant trait, what can you say about their children? Explain
- In autosomal dominant, A child who has a parent with the mutated gene has a 50% chance of inheriting that mutated gene. Likewise, there is a 50% chance of having an unaffected child Group of answer choices Both statements are correct Statement 1 is incorrect, statement 2 is correct Statement 1 is correct. Statement 2 is incorrect Both statements are incorrectThe probability of producing a normal child by two parents who are carriers for an autosomal recessive disorder is ___. 25% 75% 50% 100% 0%Which genotype indicates a carrier of an autosomal recessive trait? bb BB Bb