In mammals adaptive immune system T cells receptor are extra ordinary numerous diverse what function of immune system results from this diversity. How can it be achieved?

Q: How do plants use small organic molecules to grow bigger

A: Plants are known as primary producers because they produce their own food. They are able to produce…

Q: Create an expected result nursing care plan that emphasizes sufficient fetal oxygenation throughout…

A: The third vessel in the umbilical cord is  used to return the oxygen-rich blood to the foetus…

Q: What is homo sapiens?

A: Homo sapiens is the scientific name for the modern human beings which are a primate species. The…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: AAT CGG TCC…

A: Introduction :- In genetics, the section of double-stranded DNA known as a sense strand, also known…

Q: Which Gene encodes for the Lac Repressor that binds on the Lac Operon Operator. O Lac Z gene O Lac Y…

A: The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and…

Q: What part of the genome is used for a genetic fingerprint? A Introns Ministe OC. Chromosomes OD…

A: DNA fingerprinting is a technique that shows the genetic makeup of living things.

Q: Starting with One Cell describe and draw step by step the process of Meiosis I in males and females…

A: Reductional divisions is another name for meiosis I. Meiosis is used by both males and females to…

Q: Nitrogen fixation is the reaction of: conversion of gaseous N2 into a biologically useful form of…

A: Q. Nitrogen fixation is the reaction of: a)conversion of gaseous N2 into a biologically useful form…

Q: Which of the following factors stabilizes population growth into an S-shaped curve? a. limited…

A: Increases in a population's or a dispersed group's membership are referred to as population growth.…

Q: Determine the method of entry of a transposon into the bacteria and the identification of new…

A: Transposon:- it is also called as jumping gene because it have ability to change its position in the…

Q: Illness and infections typically cause:

A: Illness is any unhealthy condition which alters the normal body health. It could be acute or chronic…

Q: Describe how a transgenic plant can be generated using A. tumefaciens.

A: Transgenic plants are those whose DNA has been altered by genetic engineering. This implies that one…

Q: what is the lung cancer sample collection

A: Introduction Cancer is a lifestyle disease which can be caused by abnormal or unhealthy lifestyle…

Q: What is amoeba

A: Introduction Protozoa are single-celled animals. They are found in most habitats. Most species of…

Q: How would you explain cytoplasmic determinants to a 5 year old?

A: Developmental biology is the field of study that focuses on understanding how several interrelated…

Q: An ion that is essential for muscle contraction is Ca2+.  Which of the following statements about…

A: Introduction  Neurotransmitters released by the motor neuron that innervates a muscle cell cause it…

Q: Mitosis and Meiosis: Mastery Te X 不 b…

A: Introduction Cytology refers to the study of cells such as cell morphology, physiology, etc. As we…

Q: THREE WAYS IN WHICH YOU COULD APPLY THE CONCEPT - As energy flows through ecosystems in food chains…

A: The amount of energy available to organisms at each level in a food chain or web decreases as the…

Q: Which of the following would be a plant GENOTYPE The plant has two copies of the same allele for…

A: An organism's genotype is made up of all of its genetic components. The alleles or variations that…

Q: A B Density-dependent factors, like infectious disease, are more likely to strongly affect which…

A: Introduction: Numerous aspects in nature control population volume and developments. Some depend on…

Q: During what stage of the Calvin cycle are hexose sugars formed? stage 4 stage 1 stage 5 stage 2…

A: Introduction  The Calvin cycle is also known as the C3 cycle, the nighttime reaction of…

Q: What is the melting temperature and G/C content of the following primers? a.) 5’…

A: A primer is a short single strand of DNA that serves as a starting point for DNA synthesis of a new…

Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…

A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…

Q: Which of the following is true regarding the metabolism in animals? O Metabolism is the total…

A: ANSWER) Metabolic processes in animals are the chemical activities which includes both anabolic and…

Q: Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratios.…

A: The genotype is a set of a gene in DNA that is responsible for unique traits or characteristics.…

Q: Outline and describe the process of DNA replication.

A: A cell's genetic material is DNA. During mitosis or meiosis, cells divide into new daughter cells by…

Q: Could monkeypox turn into a pandemic

A: Monkeypox is the latest global public health threat caused by the monkeypox virus. The monkeypox…

Q: The per capita growth rate of the flowering rush population above from 2009 to 2016 was Answer: Show…

A: Introduction The population growth rate is defined as the change in population that occurred per…

Q: Various options are provided as possible answers to the following questions. Choose the correct…

A: Introduction: The quantity of genetic traits (alleles and genotypes) present in a species is…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" =  5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: A lawyer sets out to prove that a child with type A blood is the son of a man wi type B blood and a…

A: The blood group of an individual is determine by the alleles which determines the type of antigenic…

Q: What does smooth muscle cell do to our body

A: Introduction Animals have four types of tissues found in their body.  Epithelial tissue Connective…

Q: What is normal or “healthy” vital capacity? How do these vital capacities compare to an unhealthy or…

A: Breathing is the most vital physiological processes in our body. We take in oxygen and give out…

Q: The Old Order Amish is a relatively small population of individuals found in the United States in…

A:

Q: Draw one red blood cell and at one white blood cell. Label the cell membrane, cytoplasm, chromatin,…

A: Red blood cells are a type of blood cell found in the blood that is produced in the bone marrow. Red…

Q: In fish, having two fins (F) is dominant over having one fin (f). Complete the punnett square to…

A: Introduction :  Genotype is the genetic constituent of an organism. It is a specific genetic makeup…

Q: Cystic fibrosis is an autosomal recessive disorder that affects 1 in 3 000 newborns with Caucasian…

A: Cystic fibrosis (CF) is an inherited disorder that causes severe damage to the lungs, digestive…

Q: 1. Active immunity is acquired over the course of a lifetime by exposure to antigens. Describe the…

A: Immunity is the defensive mechanism of our body to fight against any pathogen or antigen. The immune…

Q: A swab for culture is received from a doctor's  office. The staff forgot to mention the source from…

A: Introduction Microbiology is the branch of science that deals with the study of different types of…

Q: The first animals evolved O 6 thousand years ago 9.900 O 600 million years ago O 600 thousand years…

A: Evolution is the defined as the change in characteristics of organisms or populations over many…

Q: 1. Compare the total kcals, grams of fat, and percent kcal from fat for 1 cup of whole milk, reduced…

A: The milk is a edible liquid substance with a high nutritional value. The whole milk contains highest…

Q: 7 10 P Required HOW ARE PROTEINS MADE? STEP 1: mRNA strands are select.... the select.....…

A: Translation is a process by which cell makes proteins using genetic information carried in mRNA. It…

Q: What 8 things are required to maintain life?

A: Introduction Biology is the science that investigates life. This may appear to be a foolish question…

Q: Describe 3 proteins including their normal cellular location if intracellular, normal levels in…

A: The Central Dogma theory talks of three basic and vital concepts - Replication, Translation and…

Q: Determine the appropriate bacterial strain that can be allowed to mate with the strain that is…

A: An organism's genotype is influenced by its genome as well as by its environment. It is not as…

Q: What are degenerate primers? Name two uses for degenerate primers.

A: Introduction  A primer is a small sequence of nucleic acids that serves as the precursor to DNA…

Q: Skin colour in dolphins is determined by a single gene showingincomplete dominance giving rise to 3…

A: Genes can be classified as dominant or recessive. Genes with dominant functions control what traits…

Q: Is food going down the esophagus an involuntary action?

A: Esophagus It refers to the muscular tube which connects the throat with the stomach. It is about 8…

Q: 4. The diagram below shows the process of protein synthesis. Label the numbered parts of the…

A: This picture represent the translation process which is the formation of polypeptide chain from…

Q: One of the following statements is false about flowering plants. A They all have flowers. B C D They…

A: Note: We’ll answer the first question since the exact one wasn’t specified. Please submit a new…

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.