Answered: In the extracellular phase, HIV is…

Science

Biology

In the extracellular phase, HIV is considered to be infectious Oparasitic Olysotropic O symbiotic O resistant

Comprehensive Medical Assisting: Administrative and Clinical Competencies (MindTap Course List)

6th Edition

ISBN:9781305964792

Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Publisher:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Chapter21: Infection Control And Medical Asepsis

Section: Chapter Questions

Problem 10CR

See similar textbooks

Related questions

Q: In what part of chloroplasts do the coupled redox reactions occur? stroma membrane thylakoid…

A: Introduction Plants and other living things employ a process called photosynthesis to change light…

Q: What serves as a long-term Storage area for water or nutrients

A: The areas of Earth where life is present are referred to as the biosphere. The biosphere encompasses…

Q: So yes?

A: Restriction enzyme that cuts double-stranded DNA into fragments after recognizing specific…

Q: The first step of β oxidation is: hydration by enoyl CoA hydrase. oxidation by FAD. activation by…

A: Beta oxidation In metabolism, this process is the catabolic process through which molecules of fatty…

Q: Directions: Use your basic knowledge of recombinant DNA technology to answer the question. Scenario:…

A: PCR(polymerase chain reaction) is a molecular method to make multiple copies(amplify) of a small…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: genotypes and phenotypes

A: Genotype: The genetic make up of an individual is called as the genotype. Example: Eye colour.…

Q: in horses, a classic champagne colored horse and an amber champagned colored horse produce a golden…

A: Introduction :- The horse is a domesticated, hoofed mammal with unusual toes. It is one of the two…

Q: Explain how your body monitors its hydration levels

A: Introduction: waste products can be dissolved in water, which then allows them to leave the body…

Q: Type your response in the box. Watch this video about the temperate forest biome. Explain how the…

A: Introduction:- A biome is a geographical area which is specified and characterised by the presence…

Q: During what stage of the Calvin cycle are hexose sugars formed? stage 4 stage 1 stage 5 stage 2…

A: Introduction The Calvin cycle is also known as the C3 cycle, the nighttime reaction of…

Q: Which statement about steroids is TRUE? Cytochrome P450 monooxygenase introduces oxygen atoms into…

A: Steroids are a man-made version of chemicals, known as hormones, that are made naturally in the…

Q: What leads to teenage pregnancy

A: Introduction: Adolescent pregnancy is a worldwide problem, although it most frequently affects…

Q: Which Gene encodes for the Lac Repressor that binds on the Lac Operon Operator. O Lac Z gene O Lac Y…

A: The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and…

Q: The diagram shows one possible evolutionary history based on genetic sequences from Schmidt's…

A: Introduction A phylogenetic tree is a tree-like representation that depicts the relationships…

Q: F0-Domin Activity 2 In an experiment to show co-dominance, cows with white fur (W) were crossed with…

A: Introduction According to Mendel, a gene is formed of a pair of alleles, where one allele which get…

Q: Determine the gene sequence that is amplified by the use of primers in the polymerase chain…

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: Mitosis and Meiosis: Mastery Te X 不 b…

A: Introduction Cytology refers to the study of cells such as cell morphology, physiology, etc. As we…

Q: An allosteric regulator of glycogen synthase is: UDP-glucose. cAMP. glucose 1-phosphate. ATP.…

A: Introduction: The enzymes glycogen synthase and glycogen phosphorylase control the allosteric…

Q: You then conduct a second experiment. Wild-type and C3 deficient mice are each inoculated with a…

A: Introduction A virus is an infectious microorganism made up of a protein-coated segment of nucleic…

Q: 6. Originally, two species of finches lived in the Maldives. One species had long, narrow beaks…

A: Introduction : The steady transition of an organism from a simple to a more sophisticated form is…

Q: Explain with reason the features of the human pedigree which indicate that a mutation at…

A: The heart of the cell's power is its mitochondria. It has mtDNA, or mitochondrial DNA, which is its…

Q: How can the cell in our body organize into functional structure?

A: Human body can be compared to a complex machine. In all these aspects, the human body is much like a…

Q: The darkest part of the shadow is A. Umbra B. Penumbra C. Hyperumbra D. None of these

A: Introduction :- When an opaque item blocks light from a light source, it creates a shadow, which is…

Q: Determine the reason behind the penicillin enrichment.

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: Individuals infected with herpes simplex virus (HSV) mount protective antibody responses directed…

A: The complement system of our innate immunity depends on the protein C3. C3 is another name for the…

Q: Which of the following would NOT be considered growth and development? A. a single cell getting…

A: All living organisms on earth from small bacteria to large dinosaurs share certain characteristics,…

Q: What is biology

A: Introduction Biology is the branch of science that deals with the study of living things such as…

Q: 1. Why are the finds at Malapa remarkable compared to other fossil sites in Africa? dib

A: The branch of biology known as evolutionary biology examines how natural selection, common ancestor,…

Q: ➤ Question 22 3 points Save Answer A plant has the following characteristics: a taproot system,…

A: Introduction The kingdom Plantae contains eukaryotes that are mostly photosynthetic. Algae and…

Q: Plants require light to survive because O A. plants use the energy from sunlight to produce food.…

A: Introduction The nonliving things present in the ecosystem make the abiotic components.…

Q: What did the miller-Urey experiment demonstrate

A: Introduction Miller-Urey experiment:- It is the experiment that suggests that organic molecules…

Q: Which carbohydrate is NOT produced in the pentose phosphate pathway? glyceraldehyde 3-phosphate…

A: Introduction: The pentose phosphate pathway (also known as the phosphoglycerate pathway, pentose…

Q: Germination of seeds explanation for assignment

A: The ripened or matured ovule of a flowering plant, which contains an embryo and capable of…

Q: A method which can prevent oral purge when shipping by air is to___. ligate the trachea keep a…

A: Introduction The lungs are two paired structures involved in respiration. They are situated in the…

Q: Elaborate "Biotechnology as Sociotechnical System”

A: An approach to complicated organizational work design that takes into account how people and…

Q: Analysis the features of a maize plant and classify it into the appropriate plant group

A: Plants are classified into different groups based on their features. The two main groups of plants…

Q: What is the difference between resonance energy transfer and photoinduced charge separation?

A: Animal cells produce ATP by cellular respiration, whereas plant cells produce carbohydrates through…

Q: A Moving to another question will save this response. Question 7 All plants exhibit alternation of…

A: Introduction :- In plants and algae, the alternation of generations is the most common type of life…

Q: Moving to another question will save this response. Question 10 This plant community covers about…

A: Introduction :- A wetland is a unique environment that experiences seasonal or constant flooding…

Q: Researchers investigating the role of fat metabolism in diabetes generated PPAR peroxisome…

A: Knockout mice is a mice where a specific gene is turned off that is it is unable to form a desired…

Q: What body systems are affcted by eubacterium

A: Eubacteria, sometimes known as "real" bacteria, are single-celled prokaryotic microorganisms that…

Q: Please answer fast The human revolution may be characterized as ____. It is largely untenable as…

A: Human Revolution refers to a kind of transformation that accompanies complete change in the…

Q: Define biology

A: Science is the study of nature, the way natural things behave, and how they actually work in the…

Q: DNA contains genetic code that determines... Ophysical traits O unobservable traits Ohow smart you…

A: DNA or deoxy ribo nucleic acid is main genetic material within eukaryotes such as humans. Their…

Q: 25. The cofor of orampt 24. The color of Gram 25. Bacteria are known negative bacteria is to…

A: Bacteria divide their cells through a process called bacterial binary fission. Although the notion…

Q: Is alcoholism differ from other diseases, such as, heart disease, cancer, diabetes and HIV? If…

A: Alcoholism, roughly speaking, is any alcohol consumption that causes serious issues with mental or…

Q: Can you eat tapeworms as a pill to lose weight

A: Introduction Weight loss defines the loss of entire body mass which will constitute fat as well as…

Q: If you had nucleotide sequences from virus particles from two infected hosts, could you estimate how…

A: Introduction We can be infected by various microorganisms like bacteria, viruses, fungi. Once a…

Q: Let’s say that you were also tasked with designing resistance training programs for residents at the…

A: The physical activity is any voluntary bodily movement that is produced by skeletal muscles that…

Question

In the extracellular phase, HIV is considered to be
infectious
O parasitic
Olysotropic
O symbiotic
O resistant

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Fecal-oral infections are usually a result of __________. View Available Hint(s) for Part A foodborne transmission bodily fluid transmission airborne transmission waterborne transmission
A living microbe with reduced virulence that is used for vaccinationis considereda. a toxoid b. attenuated c. denaturedd. an adjuvant
In the exoerythrocytic phase of infection, Plasmodium invades thea. blood cells b. heart muscle c. salivary glandsd. liver
Why is the AIDS treatmentoften done with a drugcocktail?
Humans are accidental hosts in many vector-borne diseases. Whatdoes this indicate about the relationship between the vector and themicrobial agent?
Defi ne zoonosis and describe the diffi culties in controlling zoonotic infections.
Keeping your food covered, especially outdoors, when it is not actually being eaten is a way to prevent contracting an illness through the ____route of infection. a. parenteral b. mechanical vector
An asymptomatic individual of a deadly communicable disease might be considered dangerous to society because they? are a reservoir can't be treated with medication are a fomite
topic: norovirus research on its:A. DefinitionB. General characteristicsC. How is it associated with food as foodborne pathogenD. Mode/Routes of transmissionE. Signs and symptoms of the disease cite your sources
The ______ phase of HIV infection is asymptomatic. This is the phase in which HIV replication establishes a steady state and virus levels in plasma reach a "set point".
Pneumocystis (carinii) jiroveci, a member of the division Ascomycetes is the most common opportunistic infection in persons with HIV.
Watch Video: https://www.youtube.com/watch?v=DueeDf9Uprg In addition to food, Norovirus is spread via aerosols and contact transmission. What is meant by this description? Can you think of environments in which Norovirus is especially worrisome?