In the very first round of PCR using genomic DNA, the DNA primers prime synthesis that terminates only when the cycle ends (or when a random end of DNA is encountered). Yet, by the end of 20 to 30 cycles - a typical amplification - the only visible product is defined precisely by the ends of the DNA primers. Explain how.

In the very first round of PCR using genomic DNA, the DNA primers prime synthesis that terminates only when the cycle ends (or when a random end of DNA is encountered). Yet, by the end of 20 to 30 cycles - a typical amplification - the only visible product is defined precisely by the ends of the DNA primers. Explain how.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.
Four different pairs of PCR primers (in blue) are shown below. Each primer is shown in the location it would anneal to its template strand. Which primer pair would best amplify the target region?
A PCR reaction was performed to amplify the XULA4 gene, which is bp 524-6,480 on a plasmid that is 9,435 bp. After the PCR, the product was digested with XhoI. There are XhoI sites on the plasmid at bp 151, 1,336, and 4,795. Calculate the size(s) that would result when the product is digested with XhoI. Then enter the size of the largest fragment (in bp).
. In the PCR process, if we assume that each cycle takes5 minutes, how manyfold amplification would be accomplished in 1 hour?
During PCR amplification in preparation for DNA sequencing, why were there different colors at the 3’ ends of the fragments produced? (What did these four colors represent?)
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
Following formation of a double-stranded break, enzymes process the dsDNA end to form single-stranded DNA as shown in Fig. 11-4b. Does it matter if resection occurs in the 5’ to 3’ direction or the 3’ to 5’ direction? Explain why or why not.
PCR errors during library amplification are one possible source of false positive results. If an error occurs in the first round of amplification, all the subsequent copies of that library fragment will also carry the variant, even though it is not present in the genome. However, reads from other library fragments spanning this same region will not have the variant, which means that identifying PCR copies, or clones, of library fragments during analysis can help to identify these types of errors. Based on what you know about PCR, which of the following statements would be true about the PCR clones in a sequencing library? A. PCR is subject to amplification bias, so reads derived from PCR clones will only map to regions that are not GC-rich. B. PCR is subject to amplification bias, so reads derived from PCR clones will only map to non-repetitive regions. C. PCR produces identical copies, so reads derived from PCR clones would map to the exact same location. D. PCR introduces many…
The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between correctly and incorrectly base-paired nucleotides at the 3′-terminus; properly and improperly base-paired nucleotides are cleaved at equal rates there. How can this observation be reconciled with the fact that the 3′-exonuclease activity increases the accuracy with which template DNA is copied?