Match each structure with its description.___ cloaca                   a. adjusts buoyancy___ swim bladder        b. multipurpose opening___ fur or hair              c. supports body___ placenta                d. insulates a mammal___ endoskeleton         e. waterproofs amniote skin___ keratin                    f. connects mother and her                                       developing offspring

Q: The embryo of monocotyledonous seed consists of one large, shield shaped cotyledon. What is it known…

A: Embryo of monocot Though the seeds differ greatly, the early stages of embryo development…

Q: If you have to choose the most obvious/important factor for a dominant transmission (between the…

A: The traits like dominant or recessive determine the inheritance patterns. These traits help in…

Q: Cytosines are methylated most frequently in CG regions in the DNA. Pre-transcriptional control…

A: * In Pretranscriptional Control  DNA methylation and chromatin packing are used. *Example Barr body…

Q: The binding between the substrate and the active site of the enzyme: O Is very specific O Resemble…

A: Enzyme is a biocatalyst. It speeds up the reaction.

Q: what anatomical system of praying mantis and crab would you recommend as a target of attack and why?

A: Mantis is insect contains over 2,400 species in about 460 genera in 33 families.Mantis are found in…

Q: What is the average level of daily nutrient intake to meet the requirement for 1/2 of healthy…

A: Nutrition- This is a biochemical and psychological process by which organisms uses food to support…

Q: Tropomyosin, at 93 kd, sediments at 2.6S, whereasthe 65-kd protein, hemoglobin, sediments at 4.3S.…

A: Introduction Tropomyosin is a 40-nanometer long rod-shaped molecule. Along the actin filaments, two…

Q: 4 Describe the Fluid Mosaic Model of the plasma membrane.

A: Introduction :- S.J. Singer and Garth L. Nicolson proposed the fluid mosaic model. This model…

Q: Please answer the following statements with true or false True False Peripheral proteins interact…

A:

Q: I. Individuals diagnosed with autism can have reduced expression of the oxytocin gene due to…

A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: Essential Elements for Plant Growth Macronutrients Micronutrients Carbon (C) Iron (Fe) Hydrogen (H)…

A: Plant nutrition involves uptake of the chemical that are necessary for plant growth. These chemical…

Q: How has “success” been defined? Where would the success be manifested—in individuals, in…

A: Success is defined as achievement of a desired outcome in an acceptable manner.

Q: A WBC count is 12.6 x 10^3/μL and there are 14 nucleated RBC's per 100 WBC on the blood smear, what…

A: 1) Given that, WBC count = 12.6 x 10^3/microlitre No.of nucleated RBCs = 14 Corrected WBC count =…

Q: Explain the significance of satellite DNA in DNA profiling technique

A: Deoxyribonucleic acid or DNA is a polymer composed of two polynucleotide chains that coil around…

Q: In eukaryotes, after the ribosomes complete a synthesis, one might expect A) a new protein molecule…

A: Protein synthesis takes place in the cytoplasm. The protein synthesis is controlled by DNA via…

Q: Among living animals, only birds have_____ . a. a cloaca c. feathers b. amniote eggs d. a…

A: Introduction :- The tissue that will become the female fetus's intestinal, genital, and urinary…

Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…

A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…

Q: Describe the difference between carrier proteins and channel proteins. What is required for the…

A: * The channel proteins are proteins that have ability to form hydrophilic pores in cell membranes…

Q: 5. Larry and Lola Little have achondroplasia, a form of dwarfism. Both are heterozygotes. Their son,…

A: Heterozygous condition is defined as a condition in which two variations of a gene known as alleles…

Q: The site where a noncompetitive inhibitor binds to an enzyme is called: OActive site O Receptor site…

A: When an inhibitor binds to the enzyme in a location other than the active site, it is known as…

Q: WW.JHAND3 2 4. Recombinent human erythropoietin (Epo) was devel- oped for for medical use. For…

A: Erythropoietin is a hormone which is secreted by cells of nephron of kidney.  Function of…

Q: Controlling for body size, would you expect a flightlessbird to produce eggs that are larger than,…

A: Flightless birds are birds that are unable to fly. These animals, which evolved from flying…

Q: Evolution of what biological process is hypothesized to have been made possible by the appearance of…

A: Introduction :- Chlorophyll is a group of green pigments found in the mesosomes of cyanobacteria and…

Q: AB blood marries a man heterozygous for Type B blood. Their children could have each of these blood…

A: Woman have blood group AB so having alleles IAIB and man is heterozygous for B blood group so allele…

Q: Which of the following enzymes has the highest functional error?  a) DNA Polymerase I b) DNA…

A:

Q: If the following truncated peptide represents the active domain of the COVID19’s S-protein…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: Answer & Classify the plants based on the physical appearance of their defense structures. If they…

A: Plant defenses are the adaptatios that reduce the damage and mortality caused by herbivores and…

Q: 5. Why do viruses with a + strand of RNA make a - strand of RNA. .

A: * virus is an infectious agent which replicates inside living cells of an organism. *They will…

Q: Which of the following statements BEST explains the relationship between the parts of genetic…

A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…

Q: If you had a template sequence of AACCGTTA, how many flushes of nucleotides would it take to get the…

A: DNA sequencing is a process which encompasses biochemical methods gor determining the order of the…

Q: ______include the only winged invertebrates. a. Cnidarians c. Insects b. Echinoderms d. Crustaceans

A: Introduction :- Invertebrates are animals that do not have or develop a vertebral column, which is…

Q: The TATA-binding protein (TBP) is thought to be necessary for transcription in all eukaryotic cell…

A: The TATA-binding protein is a generic transcription factor that binds specifically to the TATA box…

Q: What advantage does the retrovirus that causes AIDS have comparedto an RNA virus?

A: HIV is a retrovirus categorized as enveloped virus containing a single-stranded, positive-sense RNA…

Q: Unhealthy diet problem Possible Solutions (List of Different Solutions) What are the possible…

A: An unhealthy diet may cause several diseases but there are several solutions for this, a few of them…

Q: Questions 3 and 4 refer to the following diagram. Tertiary Consumer Snake Secondary d Consumer Toad…

A: The strata is very important in various ecological cycles as it keeps the consumers and producer…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase  extend or polymerise RNA.   Sigma subunit of RNA polymerase binds to promoter…

Q: Which of the following describes a strategy that can reduce land, water, and energy use in meat and…

A: Farming is the act of working the ground, planting seeds, and growing the edible plants. It can also…

Q: None of the above Which of the following is amphipathic? O Phospholipids. O Integral proteins. O…

A: Introduction :  Membrane lipids are amphipathic in nature. It has polar head and non polar tail.…

Q: In biological processes, it is often observed that various molecules interact with a functioning…

A: The term "functional protein" refers to proteins that have biological action. In animal nutrition,…

Q: What is the importance of reviewing one’s decision?

A: Decision making is the capability to take an accurate and timely response to an action. It indicates…

Q: Which of the following does NOT happen in the germinal period? a. dividing mass of cells travels to…

A: During the nine months of a female's pregnancy, an infant goes through a lot of changes. An infant's…

Q: Is the ability to modify traits an organism carries a new technology? Explain

A: INTRODUCTION The technology that is used to modify the traits of an organism is recombinant DNA…

Q: List some causes of the ongoing decline in amphibian diversity.

A: Introduction Amphibians are tetrapod animals that are ectothermic and belong to the class Amphibia.…

Q: 3. Label each diagram in Model 2 with the ion or molecule type (i.e., large/small,…

A: Selectively permeable membrane This is a membrane that has the ability to allow one few materials…

Q: Tetrapods evolved from_______ . a. sharks c. lobe-finned fishes b. teleosts d. placoderms

A: All extant and extinct creatures that evolved from the last single ancestor of amphibians, mammals,…

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It  stand for the ribonucleic acid.  is a nucleic acid present in all living cells and in some…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: the diploid somatic nucleus of xenopus has 900 copies of rDNA and in the mature oocyte it could…

A: Transcription is a process in which DNA is converted to RNA.

Q: Both protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the…

A: Isoelectric focusing electrophoresis is a technique which is used for separation of amphoteric…