Answered: Multiple 3′ cleavage sites result in a.…

Name: Multiple 3′ cleavage sites result ina. multiple genes of different len
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Multiple 3′ cleavage sites result ina. multiple genes of different lengths.b. multiple pre-mRNAs of different lengths.c. multiple mRNAs of different lengths.d. All of the above

Science

Biology

Multiple 3′ cleavage sites result in a. multiple genes of different lengths. b. multiple pre-mRNAs of different lengths. c. multiple mRNAs of different lengths. d. All of the above

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 11SA: _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids

See similar textbooks

Similar questions

Why can the transcriptome not be used to predict the proteome with complete accuracy? a. It cannot be sequenced like the genome can be. b. The transcriptome is too dynamic to be used to make predictions. c. Not all genes are transcribed. d. Many transcripts are alternatively spliced to produce different proteins.
Which of the following is/are a role for the poly-A tail? (Select all that apply.) a) Facilitates transport of the transcript out of the nucleus b) Confers stability to the mRNA c) Binds to RNA polymerase to initiate transcription d) Facilitates binding to DNA
If a splice site were mutated so that splicing did not take place, what would be the effect on the mRNA? a. It would be shorter than normal. b. It would be longer than normal. c. It would be the same length, but would encode a different protein.
Alternative splicing a. increases the number of proteins made from one gene b. increases the number of primary transcripts made from one gene c. increases the number of exons d. increases the number of introns
Which of the following statements best describes the promoter of a protein-coding gene? A. The promoter is a protein that recruits RNA polymerase. B. The promoter is part of the RNA molecule itself. C. The promoter is a site found on RNA polymerase. D. The promoter contains the AUG start codon. E. The promoter is a nontranscribed region of a gene.
How would you make a copy of DNA from an mRNA transcript,what is this molecule called, and how would it be used?
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter (c) the poly A tail (d) the intron (e) the exon
B. Briefly describe/summarize what happens in Transcription (focus on the enzymes necessary for each step, the specific location in the cell for this event, etc). C. Briefly describe/summarize what happens in Translation (focus on the enzymes necessary for each step, the specific location in the cell for this event, etc).
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
The role of p53 in normal cells is toa. create cancer-blocking mutations.b. trigger unrestrained cell division.c. detect damaged DNA.d. splice exons together in the correct sequence.
Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT