My mother who is a type 2 diabetes mellitus patient is taking empagliflozin, a SGLT2 inhibitor, for the treatment of hyperglycaemia. Based on your knowledge on renal physiology, what is the mechanism of action of a SGLT2 inhibitor? [No pharmacology details needed ]

My mother who is a type 2 diabetes mellitus patient is taking empagliflozin, a SGLT2 inhibitor, for the treatment of hyperglycaemia. Based on your knowledge on renal physiology, what is the mechanism of action of a SGLT2 inhibitor? [No pharmacology details needed ]

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

ChapterCRE2: Comprehensive Review Exam For Part 2

Section: Chapter Questions

Problem 15CEP2

See similar textbooks

Related questions

Q: 5. COVID-19 is caused by: 1. SARS-COV 1 2. SARS-COV 2 6. A disease that infects humans but…

A: COVID -19 is mainly caused by virus that became pandemic now a days.

Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…

A: Neurotransmitters are the chemical substances that is usually secreted at the nerve endings when a…

Q: Whatresults in the specificity of an antibody (i.e. one antibody can bind only one particular…

A: Antibodies are proteins that are produced in the body in response to the encouter of foreign…

Q: 3. A very large population of randomly-mating laboratory mice contains 36% white mice. White…

A: According to our guidelines we are required to answer only the first out of the given questions in…

Q: 4.What is the fate of the fertilized ovule of a flower? Read and analyze the question and choices…

A: Flower is most conspicuous , fascinating, fragranted part of plant and is major characteristic of…

Q: How did the presence of molecular oxygen in the atmosphere affect early life?

A: Life originated nearly 3.6 billion years ago in the deep ocean. The first organisms to be evolved…

Q: One of the main objectives of BI308 is to learn to think scientifically about animal behaviour. I…

A: Human behavioral ecology (HBE) is the study of human behavior from an adaptive perspective. It…

Q: Saliva helps in digestion of 1. Starch 2. Fiber 3. Proteins 4. Fats

A: Answer : saliva helps in digestion of : 1) starch .

Q: One of your classmates is planning to study endocytosis at neuronal synapses for their senior…

A: Introduction Endocytosis is the process by which the flexibility of the cell membrane enables the…

Q: 19. Independent assortment of chromosomes is a result of which of the following processes? A) the…

A: As per Bartleby Guidelines experts are allowed to answer only 3 sub parts kindly post the other…

Q: Draw a simple sketch illustrating the way in which aerobic bacteria are hypothesized to have become…

A: The origins of multicellularity and its complexities are still being debated in evolutionary…

Q: Which of the following evolutionary processes is associated with allopolyploidy? (a) gradualism (b)…

A: Allopolyploid is a term used to describe a type of polyploid. A polyploid person or strain with a…

Q: Which test percentage of each type of white blood cell?

A: In our blood composition of plasma various blood cells. RBC ,WBC and platelets are blood cells…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

Q: What substance is produced by a microorganism that is capable of the growth of other microorganisms?…

A: Antibiotics are medications that are used to prevent and treat microbial infections. Antibiotic…

Q: 1. Which of the following is the correct order for the steps in DNA extraction? I. Precipitation of…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we are…

Q: Which of the following actions would best enable you to demonstrate that the results of an…

A: *steps in scientific method involves the following steps Observation Asking a question Forming an…

Q: Fruit What is the type of fruit? What is the arrangement of the placenta? Yardlong Bean Ulam…

A: Placenta, plural Placentas, orPlacentae, in botany, the surface of the carpel (extraordinarily…

Q: H. Identify the labeled parts of the reflex arc. (Choose) TChoose Choose (Choo (Chooie (Chooe Choe

Q: Could Water Temperature Affect the Prevalence of Anisakids Nematodes in Fish? please cite sources

A: Marine life and fishes

Q: The presence of freckles is a dominant trait. Cross a heterozygous freckled man with a nonfreckled…

A: Introduction : A monohybrid cross is a genetic collaboration of two different alleles which has…

Q: Hormones secreted by endocrine glands are _________________. * A. passed through ducts B.…

A: Gland Group of cell which take certain material from tissue fluid and make new substances of them.…

Q: What is the population density of corn in a hectare if the distance of planting is 75 cm x 33 cm…

A: Here are the conversion, (1m is 100 cm) First 75 cm will be 0.75m and 33 cm will be 0.33m

Q: Describe the typical shape and structure of an antibody. Distinguish between antibodies and…

A: Since you've asked many questions, we're only answering the first three for you. If you want any…

Q: male gametophytes

A: The flower of angiosperms (flowering plants) consists of primarily sporophytic tissues, with both…

Q: NƆWER WITI KETUKT What if lost limbs or organs could be regenerated? • What if drug development and…

A: 1. Do you know the aggravation of a scratched knee? In the event that you've at any point been…

Q: Question 57 Approximately 99% of the water that is filtered in the glomerulus is reabsorbed. O True…

Q: Why heat can kill microorganisms?

A: * Microorganisms are the organism that can seen only through using microscope.They consists of…

Q: Highlight the correct answer to the questions pertaining to the coronavirus 1. A type of virus that…

A: Answers of questions regarding corona virus. Note:- According to bartleby guidelines, I can answers…

Q: 1. Why is dexamethasone not routinely used instead of prednisolone, which is almost universally used…

A: Dexamethasone

Q: laly VIII be found in each daughter cell following cytokinesis? A) 10 B) 20 C) 40 D) 80 7. How is…

A: All over the world, we can see various types of organisms. All of them have originated from a single…

Q: 1. In Harry Potter movies, Harry Potter can perform magic. His father can do the same but his mother…

A: Dominant and Recessive alleles The alleles that can only be expressed when in homozygous conditions…

Q: A few genes produce regulatory molecules that help the cell assemble proteins. The journey from gene…

A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…

Q: Question 2. What does DNA polymerase need in order to make contact with a replication origin?

A: DNA polymerase an enzyme that can synthesize a new DNA strand on a DNA template is called a DNA…

Q: In the lab, symphatetic stimulation of the heart will decrease heart rate O increase heart rate O…

A: The heart's function is to contract and pump oxygenated blood throughout the body while deoxygenated…

Q: Explain why cells need to receive nutrients (explain what nutrients are and give examples).

Q: 3. Which of the following is true for both NMDA and AMPA receptors? A. They are both only found in…

A: 3. ANSWER;-b) They are both ionotropic glutamate receptors. Explain;- Glutamate receptors. In 2012,…

Q: Given that the multiplicity of infection of bacteriophage lambda to E' coti is greater than i.0,…

A: Introduction Even bacteria can get a virus! The viruses that infect bacteria are called…

Q: . In a normal individual, heart rate can be determined by the in an ECG.

A: ECG stands for Electrocardiogram. It is a test which measures the electrical activity of heart.…

Q: Therefore the role of the enzyme is to circle one: (regulate / speed up /inhibit) a reaction by…

A: * DNA contains four nucleotide bases Adenine Guanine Thymine Cytosine * Nucleotide is the mixture…

Q: Which test measures the rate at which red blood cells settle out of unclotted blood

A: ANSWER) Erythrocyte sedimentation rate (ESR) testing is used to measure the rate at which red blood…

Q: are the advantages and disadvantages of high levels of parental care in sharks?

A: Care (1) increase offspring survival during the stage in which parents and offspring are…

Q: Humans are living longer, and that increases the risk of getting cancer during their lifetime.

Q: or function test for monitoring 2. What is the most specific liver enzyme azathioprine therapy?

A: Ans2- raised AMINOTRANSFERASE serum levels are considered most relevant to assess azathioprine…

Q: Which test measures the amount of hemoglobin in a volume of blood?

A: The term hemoglobin is associated with a protein found in the red blood cells. This protein is…

Q: ways that you can do to help your body in maintainin

Q: Devan is an athlete who always skips breakfast so he can perform his morning workout in a fasted…

A: So it should be carbohydrates and fat but it's not given. So we will choose option D - All of the…

Q: Write short notes on the functions of the following hormones: (a) Parathyroid hormone (PTH) (b)…

A: (a) Parathyroid hormone (also known as PTH) (PTH)l Its primary function is to raise the amount of…

Q: 20.Which of the following contain cells that facilitate the secondary growth or the growth in…

A: Question : 20. Which of the following contain cells that facilitate the secondary growth or the…

Q: 3.Which hormone promotes ripening of fruits? Read and analyze the question and choices CAREFULLY;…

A: Ripening in fleshy fruits induces changes such as coloure development, softening, starch hydrolysis,…

Concept explainers

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.

Question

My mother who is a type 2 diabetes mellitus patient is taking empagliflozin, a SGLT2
inhibitor, for the treatment of hyperglycaemia. Based on your knowledge on renal
physiology, what is the mechanism of action of a SGLT2 inhibitor? [No pharmacology details
needed ]

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Answer

VIEW

Mechanism

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Canagliflozin is therapeutically useful for managing type 2 diabetes because this drug decreases the renal clearance of glucose.
Mention at least 5 proteins, besides albumin, that are present in the urine under pathological conditions. Explain why a glucose test that is normally reabsorbed in the proximal convoluted tubule may appear in the urine, and state the renal threshold levels for glucose.
which of the following patients would you adminster aldosterone hypothetically to? Why? a) your congestive heart failure patient b) your hypernatremia patient c) your pulmonary edema patient d) your cirrohis patient e) your acute pancreatitis patient
Why does the ingestion ofalcohol increase diuresis?
An investigator is studying renal physiology in patients with type 1 diabetes mellitus. When a substance that inhibits glucose reabsorption is given, which of the following best describes the clearance of glucose?a. Decreases and approaches the clearance of p-aminohippurateb. Decreases and approaches the clearance of inulinC. Increases and approaches the clearance of p-aminohippurated. Increases and approaches the clearance of inuline. Increases and approaches the clearance of sodium
A steady increase in the excretion of sodium and chlorine ions causes the insufficiency of one hormone. What is the name of this hormone? Describe manifestations which appear at insufficiency or redundancy of these ions. Explain. 2. The patient was diagnosed with hypernatremia, hypokalemia, increased osmotic blood pressure, edema. a) What pathology occurs in the patient? b) Violation of the secretion of which hormone is observed in this pathology? Name its chemical nature c) Specify the mechanism of action of the hormone
A 70- year old woman comes to hospital with chronic renal failure. She was found to have hypoglycemia. What is the link between renal failure and hypoglycemia. (Subject: Clinical biochemistry)
Minimal change glomerulopathy results in proteinuria and is a major cause of nephrotic syndrome. Briefly explain (make sense of) this statement and outline the changes occurring in the filtration barrier which permit proteins to enter the renal tubules, and explain two consequences of losing plasma proteins from the body.
Diabetic nephropathy typically does NOT present as hematuria. Come up with a hypothesis why not (hint: this should involve the filtration membrane).
what are some effects of hyperkalemia and hypokalemia in the body? Would you please add explanations as why they are occurring? Thank you.
Sulfonylureas are contraindicated in all of the following patients, except:A. Patients with type I diabetes mellitusB. Patients with renal insufficiencyC. Patients with liver diseaseD. Pregnant patientsE. Patients with arterial hypertension
Why Enalapril is prescribed for kidney failure and hypertensive patients?