Q: State Washington Utah Colorado Kansas California 1059 3037 с с C C T C T C T T Position in the…
A: Answer is -- 1. Washington 2. Colorado 3. Utah 4. Kansan 5. California
Q: Briefly describe two important functions of the 5’ methyl guanine cap on eukaryotic mRNAs.
A: In eukaryotes, the nascent RNA that is synthesized by RNA polymerase II is called hnRNA…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: Can you help? I cannot seem to figure out all of the correct answers. I know lysis and budding is…
A: Cell lysis or budding both are processed for reproduction. Viruses can multiply by cell lysis and…
Q: Which of the following features is NOT a characteristic of ALL animals? Self-propelled movement…
A: Introduction:- Living Organisms are classified into various groups on the basis of presence or…
Q: Explain why it is of prime importance to analyze water supplies that serve industrialized…
A: Water pollution occurs when contaminants produced by people pollute streams, rivers, lakes, oceans,…
Q: what is the frequency of the rarest variant you can detect during deep sequencing of a tumor cell if…
A: A tumour cell is a type of abnormal cell that is produced and reproduces at an abnormally rapid…
Q: BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal…
A: Antibodies produced by B cells of white blood cells engage specifically chemically with antigens…
Q: 1.Where will a bacteria grow best: glucose, malonate, or gluconate? Explain your answer…
A: Culture media is a gel or liquid that contains nutrients and is used to grow bacteria or…
Q: #1 3. Explain how this relationship between the solution and the Elodea cells (from #1) caused what…
A: When compared to the intracellular solute concentration, an isotonic fluid has the same solute…
Q: Why is the progeny always tall when a tall pea plant is crossed with a short pea plant?
A: The offspring of two parents can be distinct from both parents due to the formation of unique…
Q: Please name any five characteristics of the human eye that contribute to its ability to capture…
A: The human eye is a sensory organ that responds to visible light and is a component of the sensory…
Q: How do virus infection and chemicals may cause cancer? Give examples and mechanisms.
A: A virus can only replicate and create new viruses by entering a live cell and taking control of the…
Q: which of the following is used to help make sure a metagenomic study has fully measured the…
A: Metagenomics is noteworthy since it may be utilized to examine assorted microorganisms found in…
Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…
A: The events that are responsible for the evolution of species from the ancestral population is called…
Q: The origin of the photosynthetic eukaryote took place when a engulfed by a later eukaryote with…
A: Two organelles - Mitochondria and Chloroplast have their own separate DNA and ribosomes. The DNA in…
Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…
A: 1 & 2) The greatest species richness refers to the number of different species that live in an…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: Introduction: The crossmatch test is a crucial component of the living donor evaluation and is…
Q: Both d) and e) answers are marked wrong by professor:((
A: A jellyfish comes in a variety of colours, forms, and sizes. The majority of the world's oceans…
Q: What is a ciliary escalator and why should I care? What would be the consequences if it is not…
A: When we breathe, the lungs exchange oxygen from the air for carbon dioxide waste from the blood.…
Q: Sahelanthropus tchadensis Anatomical structures/characteristics
A: Sahelanthropus tchadensis is the oldest known species in the human family record. This species lived…
Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.
A: Introduction: Uterus Also called womb is an important organ of female reproductive system.its main…
Q: DNA and Replication Directed Re Chapter 6.4- Traits, Genes, and Alleles (p.174) 1. What is a gene…
A: 1. Gene is a distinct sequence of nucleotides constituting a chromosome, the arrangement of which…
Q: is false because while it is true that land conversion may reduce some risks associated with disease…
A: The option A is incorrect because drought- and heat-induced increase of wildfires can have…
Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…
A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.
Q: Which is not true of Eukaryotic cells? A) A true nucleus contains DNA in the form of chromosomes B)…
A: In our body, there are billions of cells. While no two cells are identical, there are numerous…
Q: ELODEA IN THE AQUARIUM WATER FROM CONTAINER Draw what the Elodea cells looked like when placed in…
A: Aquarium water is hypotonic compared to the cytoplasm of Elodea cell.
Q: Structural differences between a B cell and a plasma cell in relation to their function?
A: Immune cells are an important part of our body that helps to protect us by developing immunity. B…
Q: DO NOT COPY IN GOOGLE OR BARTLEBY QUESTION: Why is there a need for replica plating? How is…
A: Replica plating is technique related to microbiology. In replica plating colonies inoculated into…
Q: which of these statements is false? a) a longer incubation period makes a disease more likely…
A: Any condition that damages or impairs the normal structure or function of the body is considered a…
Q: please solve these both sub-parts accurate and exact. Thank you! (a) Describe at least three…
A:
Q: The prokaryote cell type is associated with the following structures EXCEPT? a) ribosomes,…
A: The prokaryotic cells are primitive cells which do not have distinct cellular organelles. The…
Q: When fluid from ependymal cells is added to plasma it becomes: O a. cisternal fluid O b.…
A: Introduction: An ependymal cell is a specific kind of glial cell that develops into the ependyma, a…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: When the agonist cannot bind to the active receptor in the presence of the competitive antagonist,…
Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…
A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…
Q: hich of the following is true regarding the way we define clades with characters? Select one: a.…
A: A phylogenetic tree is a diagram used to visualize evolutionary relationships between organisms. It…
Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C G T A GA AТТ 5' 1. Using this strand of DNA as a…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: When will arm span and knee height be used? Are there any limitations on using these two methods?
A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: Cytotoxic T cells * MHC restricted * Antigen specific *Belong to adaptive immunity * Requires…
Q: Please match the stage of M-Phase with the correct process occurring during that time. sister…
A:
Q: A deficiency in cholesterol will have the largest effect on the activity of what organ
A: Introduction:- Cholestrol is a type of sterol. Sterols are the class of steroids that have a…
Q: Which of the following statements best characterizes genetic diversity in humans? 1.) There are far…
A: Introduction:- Biological diversity is defined as the various different types of life or living…
Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…
A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…
Q: UCUGAUGGGCUUU... Beginning with the Start codon (for Met), which amino acids, in order, are coded…
A: The correct answer is option b. methionine, glycine, phenylalanine Here, we are given the mRNA…
Q: Connective tissue comes in a variety of types. Explain how variations in this tissue type help to…
A: Connective tissue is widely distributed as well as one of most abundant tissue in our body. It is…
Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…
A: Introduction : An infectious disease is a condition that develops as a result of a pathogenic…
Q: Is ALS inherited? If so, what is the mode of inheritance (i.e. sex-linked, autosomal recessive,…
A: In familial cases, ALS can be inherited — that is, passed from parents to their children. For the…
Q: Distance en left her house and drove to college in the morning, as shown in the ccompanying graph.…
A:
Q: Sahelanthropus tchadensis Facial bones
A: Man is the result of evolution. As a result, human evolution is intrinsically related to the origin…
Q: Regarding the analysis of single marker STR results used in forensic science. Tick all the correct…
A: The true statements among the given statements are: If a suspect's alleles are different from those…
- Name and describe three mechanisms of acquired antimicrobial resistance tools that microbes may use to thwart drug action.
Step by step
Solved in 2 steps
- What are the primary medical practices that result in antimicrobial drug resistance? How can these be overcome?describe four modes of action of antimicrobial agents, and give a specific example of how each worksWhat are six mechanisms of actions of antimicrobial drugs. Include its representative drugs and cell structure involved .
- A broad- spectrum antimicrobial drug would be a drug that attacks many different microbial sites. True or false.Differentiate between the following and provide one example of each:a. antibiotics and antimicrobial drugs b. broad- and narrow-spectrum antimicrobialsDescribe four modes of action of antimicrobial agents, and provideexamples of how they work.