Q: The mechanisms of evolution that we have learned contribut organisms we have today. We can see these...
A: Endangered species are any species that is at risk of extinction because of sudden rapid decrease in...
Q: What is the essence of community service?
A: ANSWER;- Engaging in community service provides students with the opportunity to become dynamic indi...
Q: 2. Define resolution and state why is it important in distinguishing magnified objects
A: Microscope is used to see and analyse objects/organisms that cannot be seen with normal eye. In biol...
Q: How would you describe earth of millions year ago
A: It is believed that our planet Earth is about 4.54 billion years old. About 3.5 billion years ago t...
Q: Elaborate on how the modification of the insect legs/limbs better equip the insect to survive in a g...
A: Insects have legs that are adapted as per their requirement for survival in their respective habitat...
Q: 1.What stage of mitosis would be the most likely to stall if there was an issue with the microtubule...
A: Mitosis: it occurs in haploid as well as in diploid cells. It is decided into many phases such as pr...
Q: he daughter can be considered an expert witness in a scenario like this because she has knowledge, e...
A: There are few point about expert witness: As we know that now a days expert witness are very importa...
Q: When you make a gene to put into another organism, you need to combine the __________ sequence at th...
A: Answer: The transfer of new gene into another organism usually by vectors such as plasmids, and modi...
Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!
A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both....
Q: NERVOUS SYSTEM PATIENT TERMS ASSIGNMENT Identify the medical term for the following patient describe...
A: Nervous system disorder: Structural disorders in neurons present in brain , such as brain or spinal ...
Q: Which of the following is NOT TRUE about photosynthesis? O a) It takes multiple steps. O b) It.requi...
A: Photosynthesis is the light-driven synthesis of carbohydrates in plants. It takes place in specialis...
Q: They have purified a 1100 bp HindIII restriction fragment that they plan to sequence. As a first ste...
A: EcoR1: EcoR1 is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction...
Q: The chemical compound that the body uses to identify something as foreign and a potential invader is...
A: Our body's natural immune system treats something chemical or maybe some virus or bacteria or ot...
Q: 1. A disease is known to be inherited through an ADHL mode of inheritance. For a pairing of two affe...
A: ADHL: Autosomal dominant hearing loss. Autosomal dominant disease: single copy of a mutant gene has...
Q: Analyze how human actions affect the health of an environment. Use the lion fish as an example.
A: Introduction Humans have been constantly exploiting the resources of nature in order to fulfil the ...
Q: Roughly how many amino acids are there in one turn of an alpha helix
A: Solution : Correct option is C
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: *NOTE: Kindly repost for other questions. * Dear Student as per the guidelines we are supposed to a...
Q: What is the coagulation cascade? Why is it important? b) Explain the steps of the foreign body resp...
A: Introduction The way the body defends against what it considers harmful or foreign substances. In an...
Q: What are the two main types of transport proteins? What are their functions?
A: The act or means by which a molecule or ion is transferred across the cell membrane or through the b...
Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from supercoili...
A: DNA ligase:- DNA ligase works by catalyzing the formation of a phosphodiester bond between nucleotid...
Q: What types of molecules pass easily through the plasma membrane?
A: Plasma membrane plays important role in cell function and in the life process of living organisms. I...
Q: . Gene ? A. Epistasis B. Height C. Red Petal D. Flower Color E. Lethal Factor 2. Sex chromosome synd...
A:
Q: antibacterial drugs in depth and the affect this issue is having on society
A: Antibiotics, also known as antibacterials, are medications that destroy and slow down the growth of...
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence. T...
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding r...
Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...
A: In this following pedigree shows total 3 generation, 13 family members where 10 members are affected...
Q: If you had a liquid culture containing three different species of bacteria, how could the use of a P...
A: A microbiological culture, also known as a microbial culture, is a technique for multiplying microor...
Q: ) Does the fossil record indicate that life first appeared in the water or on the land? ...
A: Fossils are the preserved remains of plants and animals whose bodies were buried in sediments. like ...
Q: QUESTION 4 A person with agammaglobulinemia: cannot produce antibodies cannot produce interferons do...
A: Agammaglobulinemia is a inherited disorder in which, person has low levels of protective immune syst...
Q: What is cell signalling.
A: Cell signaling It happens in a variety of ways, but the common thing is that the actions of one cell...
Q: What is the algorithm used to find homology?
A: The nucleotide is an organic molecule that functions as a DNA and RNA building block. They also have...
Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron m...
A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription...
Q: Why is bacterial culture useful to grow bacteria?
A:
Q: Which of the following is NOT part of the first line of defense? fever
A: The many defensive categories of the innate immune system do not work individually, rather they are ...
Q: In the Pea plants studied by Mendel, green pod colour is dominant over yellow pod colour. You have g...
A: Pure line: A strain of homozygous, true breeding organisms formed either through repeated self-ferti...
Q: 4. Fill in the blanks below to identify three examples of sister relationships. i. Descendant is sis...
A: Monophyletic group consist of composed groups of organisms that show most recent common ancestor and...
Q: If you were given the task of determining the approximate % solute of potato cells. You decide to se...
A: The process of osmosis is the transport of water or solute molecules across a semipermeable membrane...
Q: Identify the Bryophyte and if it is in its haploid or diploid reproductive state. A hornwort Haploid...
A: Bryophytes are categorised into three groups of embryophytes(non-vascular plants) these are: Liverw...
Q: What does a cofactor do?
A: A biomolecule that is not a protein is referred to as a cofactor. Any metal ion or organic molecule ...
Q: What impact does the time of day, days of the month, or place where the tasks are completed have on ...
A: Clinical psychology is a branch of psychology that provides people and families with ongoing and com...
Q: he cuticle is a complex non-cellular layer secreted by the epidermis. It is the seat of complex proc...
A: The main composition of hemolymph in insects is water, other substances includes amino acid, hormone...
Q: Please type the answer this question
A: Organisms that live in water or fly in air have streamlined shape body.
Q: What is cell cycle
A: A cell is a collection of cytoplasm that is outwardly contained by a cell membrane. A cell cycle is ...
Q: Describe a nucleic acid.
A: Nucleic acids carry and store information and pass this information from parent cells to daughter ce...
Q: explain the results of this experiment Table 1 Absorption Spectrum of Cobalt Chloride Using a Spe...
A: We know that the calibration curve can be used to determine the concentration of an unknown substanc...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Myoglobin is a carbohydrate which in normally found in muscle tissue. True False Chromatin is compos...
A: It specifies a single polypeptide chain with one oxygen binding site. Myoglobin has a heme prostheti...
Q: Explain : Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages
A: Vpr means viral protein R and it is a HIV gene and protein product. This gene is responsible for vi...
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: Insects are adapted their environment in many ways. An adaptation is an adjustment to the environmen...
Q: Describe the smaller and largest living unit of nerve cells
A: "The nervous system" of all animals is made up of unique cells known as neurons, which serve as the ...
Q: vector pUST, gene W, and the restriction cut sites. What are 3 cutting strategies for cloning gene W...
A: *Cloning means producing an organisms with identical DNA either by natural or through artificially ....
Which enzyme will they use to stick the fragment and the plasmid together?
Step by step
Solved in 3 steps
- HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)Enhanced Spatial Learning Ability in Mice Engineered to Carry an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory. Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451. In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability. Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface or a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platforms location by checking visual cues around the edge or the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some or Tabuchis result. FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3(R451C) were tested for learning performance: as compared with unmodified (wild-type) mice. In the first test, how many days did it take unmodified mice to learn to find the location of a hidden platform in 10 seconds?SspI --- 5' AAT - ATT 3'5' GGATAATATT GTTAACAATCTCTACGGGTTAACACCCTTGGAATATTTTAA 3' 3' CCTATTATAACAATTGTTAGAGATGCCCAATTGTGGGAACCTTATAAAATT 5' Number of pieces of DNA _______
- Explain the equation E+S---->ES----> E + P.why wxactly 20Atp not 24?Enhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 1. In the first, how many days did it take unmodified mice to learn to find the location of the hidden platform within 10 seconds?
- The photos below show flowers from two Arabidopsis plants. The plant on the left is wild-type (unmutated); the other carries a mutation that causes its flowers to have sepals and petals instead of stamens and carpels. The mutation inactivated one of the plant's ABC floral identity genes. Refer to Figure 10.8 and decide which gene (A, B, or C) has been inactivated.Cervical Cancer Incidence in HPV-Positive Women A persistent infection with one of about 10 strains of genital HPV (human papillomavirus) is the main risk factor for cervical cancer. The virus spreads easily by sexual contact, but vaccines that prevent infection have been available since 2006. The vaccines consist of viral proteins that self-assemble into virus-like particles. The particles are not infectious (they contain no viral DNA), but their component proteins trigger an immune response that can prevent HPV infection and the cervical cancer it causes. In 2003, Michelle Khan and her coworkers published results of their 10-year study correlating HPV status with cervical cancer incidence in women (FIGURE 37.23). All 20,514 participants were free of cervical cancer when the study began. FIGURE 37.23 Cumulative incidence rate of cervical cancer correlated with HPV status. HPV16 positive HPV16 negative and HPV18 positive All other cancer-causing HPV types combined No cancer-causing HPV types was detected. At 110 months into the study, what percentage of women who were not infected with any type of cancer-causing HPV had cervical cancer? What percentage of women who were infected with HPV16 also had cancer?Decoding a DNA Message 1. CGA ACT AGA TAA CCC TTA TAG AAA TAT ACA CGC TTG TGA AAC ATA ATC CGG CTG CAA CGT TTA ACA CTC CTA ATT AGG ACA TAA CTC TTG ACA CTT ACT TAG AGA ACT CTC CGC TCA TAG GAG ATA ATT TAC TAA AGA TGA CGG TTT CTT TTG ACT CGA AGC ATT TAC CGC CCC TAG ATC 2. AAT CTC CGA GCT TTG TAG TTA CCC ATT TAG AGT ATC TAG TTG TGT CTC GCT CTC AGG TGC TAT TTG CCT ACT
