answer for 14, 17 electrostatic pressureQUESTION 17local chargeresting potentialQUESTION 189r 100 110 120 13 14 15 16 17Theis defined as the difference in electrical charge between the inside and the outside of a patch of axon that an action potential is not currentlymoving through.O resting chargeO local potentialWhen the action potential reaches the terminal button, which of the following happens first?calcium channels openClick Save and Submit to save and submit. Click Save All Answers to save all answers.Type here to search180 190O20 2122 230 240 2526Save All AnswersRain off and on F← →сbbhos 1.cuny.edu/webapps/assessment/take/launch.jsp?courRemaining Time: 08 minutes, 04 seconds.✓ Question Completion Status:QUESTION 14An Inhibitory Post-synaptic Potential (IPSP) will be produced when a neurotransmitterO opens a potassium channelO closes a sodium channelcloses a potassium channelO opens a sodium channelBb TaClick Save and Submit to save and submit. Click Save All Answers to save all answers.

Resting charge occur when a neuron is negatively charged at rest .Inside a cell approximately 70…

QUESTION 17 The is defined as the difference in electrical charge between the inside and the outside of a patch of axon that an action potential is not currently moving through. O resting charge O local potential O local charge O resting potential

QUESTION 17 The is defined as the difference in electrical charge between the inside and the outside of a patch of axon that an action potential is not currently moving through. O resting charge O local potential O local charge O resting potential

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter12: The Nervous System And Nervous Tissue

Section: Chapter Questions

Problem 7ILQ: Watch this video (http://openstaxcollege.org/l/summation) to learn about summation. The process of...

See similar textbooks

Related questions

Q: 4. Consider the different types of SNPs shown in Figure 3: associated, unassociated, and causative…

A: As per our Q&A guidelines, we are supposed to answer only three subparts. Please repost the…

Q: Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’…

A: Transcription is the first stage of gene expression, in which a particular segment of DNA is copied…

Q: Q1.11. What is an ecological community? A group of individuals from a given species that interact A…

A: A subfield of research called ecology includes the fields of human science, demographic, population,…

Q: Your lab partner set up plate 4 by spreading a pure culture of E. coli onto the plate and addind…

A: Escherichia coli, more commonly known as E. coli, is a type of bacteria that is commonly found in…

Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…

A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…

Q: Vertebrate phylogenetic tree St. bony fish amphibians mammals turtles lizards snakes crocodiles…

A: sister taxa are pairs of terminal taxa branch from a common node and are often closely related…

Q: 3. Type of Transport: Reasoning: Balanced Concentration (Equilibrium) Describe the cell membrane as…

A: Type of transport : Osmosis Reason: Osmosis is a type of transport system for subsatnces through…

Q: Question: The vast majority of calico and tortoiseshell cats are female, however occasionally a male…

A: Yes, the majority of tortoiseshell cats are female. This is because the gene that determines the…

Q: This figure represents the ABC operon, which is a negative inducible operon, and its associated…

A: ANSWER: Functional structural proteins formed in the presence of molecule A are: test 1, test 2 and…

Q: The antibiotic, tetracycline was serially diluted (2-fold dilutions), starting with tube #1 (100…

A: Serial dilution is a mathematical way of lowering the concentration of any solution in a gradual…

Q: # 1. Match the following with the correct type of ecology: Use checkmark Population Community…

A: Ecology is the branch of biology that deals with the study of interactions between organisms and…

Q: Many people of Asian ancestry have alcohol dehydrogenase enzymes that are far more efficient than…

A: We know that Alcohol (Ethanol) gets converted into acetaldehyde with the help of enzyme alcohol…

Q: Determine the experimental design that makes the difference between the given two modes of action at…

A: The antisense ribonucleic acid is a type of single-stranded ribonucleic acid molecule that binds to…

Q: Why is heating important in endosperm staining procedure?

A: Staining is a technique used to make certain structures in a sample more visible under a microscope.…

Q: What does the medial corticospinal tract control? A. Bilateral movements of the trunk of the body B.…

A: The anterior corticospinal tract sends fibers mainly to the trunk or axial muscles.

Q: Increase of ATP concentration Dephcsphorylation of glycogen phosphorylase Increase of glucose-6-…

A: Glycogen synthesis Glycogen synthesis , also called glycogenesis is the process by which the liver…

Q: Pick either the pincushion cactus or the barrel cactus. Conduct an analysis and determine whether…

A: One of the most common cactus kinds for use as succulents is the barrel cactus. It is also one of…

Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…

A: Introduction: Our body have different kinds of nervous system such as central nervous system…

Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…

A: In plants, Photosynthesis is the process of making food (glucose) and releasing oxygen by utilising…

Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…

A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…

Q: How does intron splicing work? Draw the mechanism. Label the branchpoint and lariat structures.

A: Introns are the non-coding regions of a DNA or an RNA sequence, whereas, the exons are the coding…

Q: 2) The intermediate disturbance hypothesis proposes that __________. A. the highest diversity in…

A: Introduction: The number of various species present in an environment and the relative abundance of…

Q: Aspirin inhibits cyclooxygenase enzyme. This enzyme makes the prostaglandin hormone type your…

A: INTRODUCTION Thromboxane This is a hormone that plays an important role in platelet aggregation,…

Q: Descibe the the date is the graph, what does it show and mean.

A: The given describes the number of days of antibiotics administered to 149 pet store puppies assessed…

Q: What is the new DNA sequence and the corresponding new amino acid sequence of these two mutations?…

A: Mutation is any change in the DNA sequence. These are of different types for example, missense…

Q: Which ingredient(s) cause MSA plates to be selective?

A: MSA (mannitol salt agar) is a kind of selective media that is used for growing, isolation, and…

Q: e. On the stretch of mutant viral RNA below, draw translation in progress. Draw the following: ●…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…

Q: How does staining procedure relates to the benefit endospores provide to cells?

A: Endospore Staining-The main purpose of endospore staining is to differentiate bacterial spores from…

Q: 5. In the absence of mutation, the heritability of neck length in a population of giraffes would…

A: Evolution refers to the change of characteristics of a population that can be inherited from one…

Q: Why do many tumors metastasize (e.g. what advantage does it give them) and why can metastatic…

A: Metastasis is a complex process that is not fully understood. However, it is clear that the ability…

Q: The Epithelial-Mesenchymal Transition (EMT) is mediated by which of the following (select all that…

A: EMT or epithelial-mesenchymal transition is a series of events that allows a polarized epithelial…

Q: In January 2010, a population of organisms had a size of 564. By the end of the year 109 of those…

A: In january 2010 , population of organisms had a size of 564 By the end of the year 109 had died so…

Q: What is it called when some nutrients can not be adequately measured to create an RDA or EAR value?

A: Dietary reference intake consists of 4 reference values based on nutrition according to their…

Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: Q4.14. Recall that in the big Yellowstone fires, lodgepole pine burned and then grew back within…

A: Introduction: Lodgepole pine (Pinus contorta var. latifolia) forests is the highly resilient to…

Q: EVOLUTION LINK Explain some of the evolutionary implications that one can conclude from mice and…

A: Introduction Heritable traits—the hereditary features of an organism—change over the course of…

Q: Compare and contrast the different experiments of Redi,Needham,Spallanzani and Pasteur on the origin…

A: Origin of life has many theories with various interpretation. Each and every theory differs from one…

Q: A student wishes to carry out an investigation to determine the role of the drug CORA against MCF-7…

A: Cancer is a broad term used to describe various diseases in which abnormal cells divide and grow…

Q: Use the shapes tool to outline the following: ETC in Blue NADH Pre-work 1 Proton gradient in Red…

A: The "electron transport chain is a series of redox processes that transmit electrons from a source…

Q: Major event of special creation theory

A: The research of how life on Earth emerged from non-living materials is known as abiotic biology,…

Q: ob woH svo od bolles et fill de 2. From the information given in the chapter about the ABO blood…

A: Codominant alleles establish the blood type of an individual. The IA, IB, and I genotypes are three…

Q: How to calculate Km value and Vmax in buffer 1 and 2

A: The enzyme kinetics can be represented by the Line Weaver Burk Plot. This is a plot made by plotting…

Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…

A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…

Q: 2. A quantitative genetics determined the following variance components in a population of crabs…

A: Introduction: As per the given information: "The total variance or phenotypic variance (VP) is the…

Q: Which of the following best supports the endosymbiotic theory of the evolutionary origin of…

A: Except for chloroplasts, mitochondria don't seem to have a common ancestor with any other organelle.…

Q: please give an evolution timeline about dogs. (7 keypoints please) Please use the format below

A: The domestic dog, also called as Canis familiaris or Canis lupus familiaris, has earned the title of…

Q: What is the concentration of a DNA solution with an OD260 measurement of 3.175 if 1OD unit at 260nm…

A: Introduction : A material's optical density describes its slow tendency for holding onto the…

Q: what scale of study would you study as an Community ecology

A: Introduction Ecology is a branch of science which deals with the study of the relationship between…

Q: Compare the sample variances of P1 and P2. Account for any differences. Similarly, compare the…

A: P1 and P2 have the difference of 0.95 in their variance. This denotes that there would be variations…

Q: Based on the knowledge acquired about the conservation and propagation of microorganisms, propose…

A: Yeast is a eukaryotic organism that belongs to the fungus kingdom. It is single-celled and is used…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

answer for 14, 17

F
← →
с
bbhos 1.cuny.edu/webapps/assessment/take/launch.jsp?cour
Remaining Time: 08 minutes, 04 seconds.
✓ Question Completion Status:
QUESTION 14
An Inhibitory Post-synaptic Potential (IPSP) will be produced when a neurotransmitter
O opens a potassium channel
O closes a sodium channel
closes a potassium channel
O opens a sodium channel
Bb Ta
Click Save and Submit to save and submit. Click Save All Answers to save all answers.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which factors contribute to an axon’s conduction velocity? comments: Please understand the question well than answer . Im using bartbly to hence my knowledge
My question is how can temporal summation of synaptic potentials make it easier for a neuron to reach action potential threshold?
My question is how can spatial summation of synaptic potentials make it easier for a neuron to reach action potential threshold?
In chemical synapses, neurons communicate with other neurons or skeletal muscles via neurotransmitters (NT). Explain the steps of neurotransmission beginning from the action potential arriving at the axon terminal to the termination of NT actions. (answer max 8 sentences)
Post-tetanic Potentiation in synapses :-a- is due to increased Ca ++ concentration in postsynaptic neuronsb- is due to increased Ca ++ influx into presynaptic neuronsc- results from slow prolonged stimulation of synapsed- causes fatigue of the synapse
Intro to Neuro Question: The striatum has an (excitatory/inhibitory) connection to the globus pallidus external. Activation of that connection (increases/decreases) activity in the globus pallidus internal, ultimately (promoting/suppressing) movement.Group of answer choicesExcitatory, increases, promotingExcitatory, increases, suppressingInhibitory, decreases, promotingInhibitory, decreases, suppressingInhibitory, increases, suppressing Is my reasoning correct? The striatum has an inhibitory connection to the globus pallidus external (GPe). Activation of that connection decreases activity in the globus pallidus internal (GPi), ultimately promoting movement. Thus, the correct group of answer choices is: Inhibitory, decreases, promoting
Match the stages of action potential with the appropriate image or description. 1. Resting membrane potential 2. Threshold 3. Depolarization 4. Repolarization 5. Hyperpolarization 6. Refractory period The potential difference that must be met in order for an action potential to be generated When the potential drops below resting level When the potential starts to decrease again after it has reached a maximum Occurs at -77 mV When the membrane is resetting and an action potential cannot yet be produced again When the sodium channels are open Occurs at -55 mV
Synaptic fatigue is due to : -a- decreased synthesis of neurotransmittersb- inability to release neurotransmitters by exocytosisc- failure of action potentials to open voltage-gated Ca ++ channels in presynaptic terminald- imbalance in between rates of synthesis and release of neurotransmitters
Summarize the steps in generating an action potential as a flowchart. You can make your flowchart on paper and take a picture of it, or make it electronically. Be sure you’ve included: the location in the neuron and components of the neuron involved, the types of cellular transport and ions involved, how action potentials can be stimulated and inhibited. you can get the information from this: https://youtu.be/HYLyhXRp298
Synaptic transmission s terminated by :-a- block of pretsynaptic receptorsb- elevation of Ca ++ concentration in synaptic cleftc- reuptake of neurotransmitters by postsynaptic neuronsd- degradation of neurotransmitters by specific enzymes
Please ASAP. thanku The response of ligand gated ion channels is transient because ___ (can choose more than one option) a. ligand unbinds and is claered from teh synapse quickly b. the channels desensitize c. the cahnnels inactivate d. amino terminus is truncated
4 Which of the following would be an example of spatial summation that produces a depolarizing effect at the postsynaptic neuron? Resting membrane potential is -70 mV and threshold is -55 mV. Group of answer choices IPSP of 10 from neuron A followed in close succession by a 2nd IPSP of 5 from neuron A Simultaneous application of an IPSP of 5 from neuron A and an IPSP of 10 from neuron B Simultaneous application of an EPSP of 5 from neuron A and an EPSP of 10 from neuron B EPSP of 10 from neuron A followed in close succession by a 2nd EPSP of 5 from neuron A