QUESTION 2 Which of the following is NOT true of cutting DNA in biotechnology? O A. A molecular biologist can cut DNA using restriction enzymes. O B. DNA can be cut at specific base sequences called recognition sequences. When DNA is cut in such a way that some of the bases are no longer paired with their complements, the unpaired ends of that DNA fragment are OC. called sticky ends. If the piece of DNA shown below is cut with an enzyme that cuts at "GGCC", 3 fragments would result. OD. DNA: GTATGACTGAATTCCCAGGCCATCTCCGGA

Q: QUESTION 6: What would the PCR product be for the following DNA sequence at the end of one cycle of…

A: Polymerase chain reaction ( PCR)  *Polymerase chain reaction is a technique which will  make…

Q: QUESTION 18 Which of the following is/are true regarding the enzyme PRIMASE? Primase functions…

A: Replication is a biological process by which DNA (deoxyribonucleic acid), the genetic material of…

Q: QUESTION 18 Which of the following statements about termination mechanisms for nucleic acid…

A: Transcription termination is the process where a nascent RNA is released from its complex with RNA…

Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…

A: Given: Recognition sequence for the enzyme: 5' - GGATCC -3' - Every restriction site is a…

Q: Question 1 What gives the DNA molecule a negative charge? A deoxyribose B ribose phosphate groups…

A: DNA and RNA are made up of nucleotides. The nucleotides are building blocks that are made up of a…

Q: QUESTION 3 Which types of mutations lead to frameshifts? O Deletions only Insertions only Insertions…

A: Protein synthesis is the process by which instructions present in DNA is converted into proteins,…

Q: QUESTION 1 Which of the following is NOT true of B form nucleic acid duplexes? O It is the form…

A: B-DNA is the Watson-Crick double helical structure. It is most stable and predominant structure…

Q: QUESTION 1 What is a restriction enzyme? O a. enzymes that can cleave DNA molecules at or near a…

A: Introduction Enzymes are proteins that help speed up chemical reactions in our bodies, They build…

Q: Question 15 Which of the following types of RNA is most abundant in a typical cell? A messenger RNA…

A: 15. The most abundant form of RNA is rRNA or ribosomal RNA because it's responsible for coding and…

Q: QUESTION 23 Which of the following is true for DNA replication but not RNA transcription? O It…

A: Gene flow occurs through DNA to RNA to proteins. This is central dogma involving processes like…

Q: Which of the following statements regarding the structure of DNA inside cells is NOT correct?   A.…

A: DNA : Double helix  A: Adenine G: Guanine T: Thymine C : Cytosine

Q: QUESTION 4 Which of the following DNAs is most likely to contain the recognition sequence for a…

A: DNA (Deoxyribonucleic acid) recognition sequence is a specific linear sequence that is recognized by…

Q: QUESTION 7 Which direction will DNA move on an electrophoresis gel? always toward the (+) electrode…

A: Gel electrophoresis is a technique that is used to separate the fragments of DNA or proteins on the…

Q: How did you select and grow a streptomycin resistant strain of bacteria in this experiment? 1. A…

A: In a bacterial Colony some genes are antibiotic resistant and by conjugation these transmit their…

Q: Question 3 Choose the false statement below. O CRISPR is a protein complex which causes the…

A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…

Q: Why are consensus sequences found in cis-elements typically only 5-6 bases long? Question 19…

A: The consensus sequence is the calculated order of most frequent residues, either nucleotide or amino…

Q: o isolate DNA from cells, you must disrupt the cell Therefore, you treated your cells with a lysis…

A: Cell lysis or cell disturbance is a strategy wherein the external limit or cell film is separated or…

Q: QUESTION 4 What is the most common mechanism among eukaryotes for increasing the number of…

A: eukaryotic nuclear genome:  it is linear embedded in nucleosomes  it validates the model of…

Q: QUESTION 3 Is it possible to dissolve DNA in water? a. Only during cell division O b. No, DNA is…

A: Genomic DNA is the set of DNA which comprises of the genome of an organism. The genome is the…

Q: Question 10. Which of the following models best describes how DNA is replicated? A. Conservative B.…

A: Introduction :- The process of replicating a double-stranded DNA molecule into two identical DNA…

Q: Question 38 Which of the following process about conjugation is NOT true ? When a part of the…

A: Conjugation may be defined as the temporary union of two bacteria or unicellular organisms for the…

Q: QUESTION 24 What is the name of chemical agents that alter specific bases within DNA after completed…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Question 6 Which of the following is true of the base content of dsDNA? A moles of thymine = moles…

A: There are four nitrogenous bases of DNA which are Adenine,  Guanine, thymine, and cytosine.  Guanine…

Q: Question 4. Why is a single-stranded, circular DNA an ineffective template for DNA polymerase?

A: Introduction Single-stranded DNA is a DNA molecule that has only one nucleotide strand while…

Q: QUESTION 1: Several factors (including agarose gel concentration, time and current) affect migration…

A: To separate DNA using agarose gel electrophoresis, DNA is loaded into pre-injection gel and then…

Q: Question 5: Try cutting Plasmid 1 with Xhol. Xbal. Kpnl, and Pstl. Try cutting with all 4 together.…

A:

Q: Question 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA…

A: Primer is a small sized single stranded monomeric nucleotide needed by all living creatures to start…

Q: Question 1 A scientist constructs a recombinant bacterial plasmid that contains a gene conferring…

A: Antibiotics are usually defined as the way that they are been medications that are used to treat…

Q: QUESTION 11 Which of the following is NOT a tool/material used for genetic engineering matched…

A: Genetic engineering is the method of replication of a particular group of genes from DNA strand. In…

Q: Question 18 What is the complement of this sequence of DNA: 5'-CCTATCGA-3'? O 3'-AGCTATCC-5'…

A: Only the letters A, C, G, and T appear in the DNA sequence. A DNA sequence is a "macromolecular"…

Q: QUESTION 3 Is it possible to dissolve DNA in water? a. Only during cell division b. No, DNA is…

A: A solution is a combination of two compounds or more. The solute is the soluble material, and the…

Q: QUESTION 8 Check all the statements that are TRUE regarding 16S or ITS (microbiome) illumina (NGS)…

A: The Illumina sequencing chemistry is extremely precise, with the great majority of bases scoring Q30…

Q: QUESTION 2 What is the most common mechanism among eukaryotes for increasing the number of…

A: An error in deoxyribonucleic acid (DNA) replication results in the formation of short genetic…

Q: QUESTION 4 Which length of DNA fragment would move the fastest and farthest during an…

A: Gel electrophoresis is general lab techniques to determine the quality and quantity of DNA/RNA in…

Q: Question 7. You are studying two strands of DNA. They have exactly the same length, but the first…

A: The melting temperature highly depends on the G+C ratio in a strand. More the ratio of G+C high will…

Q: These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA…

A: DNA is the type of genetic material present in the organisms like humans and plants. The structure…

Q: Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced…

A: Since you have posted multiple questions, we solve the first question for you. To get the remaining…

Q: QUESTION 11 What is the purpose of homogenization? OIt increases the absorption of DNA molecules.…

A: Please note that keeping up with policy at Bartleby and in order to provide accurate answers with…

Q: Question 2. What does DNA polymerase need in order to make contact with a replication origin?

A: DNA polymerase an enzyme that can synthesize a new DNA strand on a DNA template is called a DNA…

Q: Question 1 Review DNA sequencing, which method uses a dideoxy chain termination? O Next-generation…

A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors utilised in the Sanger technique…

Q: Question 1: If Precambrian is to Algae then Paleozoic is to ______________;  A. Dinosaurs B. Birds…

A: As per our company guidelines we are supposed to answer only first question.  kindly repost another…

Q: Question 3 If the fragments of DNA shown below were to replicate with the origin of replication at…

A: Introduction  DNA is a self replicating molecule. DNA replication is a process by which one DNA…

Q: Question 33 Which of these genes would be on the bacterial chromosome, rather than on a plasmid In…

A: Bacterial chromosomes are located in a nucleotide, a distinct cytoplasmic structure in which double…

Q: Question 9 Which of the following statements about Genome-wide association studies is NOT true? O A…

A: Genome wide association study  It is the technique to detect the association between genetic…

Q: QUESTION 28 All of the following statements about the Illumina (reversible terminator) process for…

A: Next-Generation sequencing also called high throughput sequencing or second-generation sequencing or…

Q: Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing…

A: DNA sequencing is a method that gives the order of nucleotide bases. Methods used for DNA sequencing…

Q: QUESTION 3 Look at the following piece of DNA cut with enzymes I and II, crating 3 fragments; A, B…

A: Agarose gel electrophoresis isca technique used to seperate the DNA molecule based on their…

Q: Question 21 (1 point) Based on what we learned, what is true about E. Coli DNA replication? The…

A: DNA replication is the process of synthesizing new DNA strand on a template DNA strand by the help…

Q: Question 1: Which of the following processes is not involved in genetic engineering?  A. DNA…

A: The recombinant DNA technology involved transferring the desire DNA into a specific host cells in…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.