QUESTION 7 SR proteins bind to splicing enhancers and activate splicing by recruiting spliceosome components. Mutations that affect SR proteins will have what kind of effect on gene expression? O General transcription factors will be unable to bind to promoters. O Splicing of the mRNA will not be activated. O Ribosomes will not be able to bind to mRNA molecules in the cytoplasm. O Polyadenylation at the 3' end will be blocked. O RNA polymerase will be unable to terminate transcription.

Q: are bacterial cells eukaryatic or prokaryotic?

A: Cell is a microscopic structure exhibited inside the living organisms . It can be one in number or…

Q: Of what value is the plant pathogen Agrobacterium?

A: A plant pathogen is an organism that infects plants. While certain plant infections can affect…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…

A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…

Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 100 to 10-7…

A: Original titer of Phage lysate = 3.7 * 104 cfu/mL A 100 dilution essentially means that the sample…

Q: A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in the diagram…

A: In its broadest definition, a haplotype is a collection of DNA changes along a chromosome that tend…

Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…

A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…

Q: Question: Match the following terms with their meanings from the drop down menus. Water potential…

A: Introduction Cell transports are the movement of a substance through the cell membrane. The…

Q: The students of a Microbiology class were tasked to transfer or subculture a pure culture of…

A:

Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…

A: In evolutionary biology, mimicry refers to an organism's developed likeness to another thing, most…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: The name of the person who has autism, is an expert on the condition and has written about how…

A: Science and technology have advanced to the point that we can now determine the origins, signs, and…

Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…

A: The process of urine formation is done in the nephrons present in the kidneys. The nephrons are…

Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…

A: The neurons are the basic functional unit of the nervous system in our body. Neurons can receive the…

Q: Change in gene frequencies within a reproductive population is called: O allopatric speciation. O…

A: Evolution is defined as a change in the inheritable traits of biological populations, over multiple…

Q: Draw the keto or enol tautomer for each of the following compounds when they were treated with…

A: 1. Propanol on being treated with traces of acids or bases, its structure is converted to Propanone.…

Q: Leos results were like the followings Time Color Specific Gravity Protein Glucose pH Before exercise…

A: ADH or anti diuretic hormone is produced by hypothalamus. It is released into blood and it helps in…

Q: Substance that moves the electrical field solely depends on the speed of the substance in the…

A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…

Q: Which theory of aging states that unstable oxygen molecules tend to steal electrons as they bounce…

A: The unstable oxygen molecules have higher energy and can damage the biomolecules.

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: The proteins work together to cause the release of the transcription factor that is bound by the…

A: Answer is D p53

Q: From the early 1700s to the modern day, how did various lines of evidence refine scientists'…

A: Cetacean is classified as a group that comprises whales, and dolphins along with the porpoises.…

Q: In the 33 hr. chick embryo stage what structure/s would serve as a guide to approximately…

A: Auditory vesicles are distinct. Three pairs of arterial arches arise from the ventral aorta. Somites…

Q: 9. Explain how a small amount of growth factor can mediate an amplified signal inside the cytoplasm…

A: Signal transduction pathways translate signals received at the cell's surface into cellular…

Q: Describe how Separase, plays a critical role during meiosis and mitosis.

A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…

Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…

A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…

Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…

A: Homeostasis is defined as the state of maintaining body balance among all the body systems that is…

Q: 5

A: Answer cat ovary with labelling

Q: Sex linked 6. traits are those found on the chromosomes determining gender, and show up more often…

A: Multiple allele is a condition and according to that, In a gene there are more than two alternate…

Q: Describe the behavioural and physiological adaptations that enable many rodents to thrive in arid…

A: Introduction "Adaptation is a physical or behavioural trait of an organism that aids in the…

Q: How do Restriction Enzymes like EcoRI work?

A: Restriction endonucleases  are the enzymes which is used to cut particular region of DNA . They make…

Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?

A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…

Q: The ability of oxygen to bind hemoglobin changes with altitude as shown. Which statement, if true,…

A: The binding of oxygen and heamoglobin depends on the partial pressure of oxygen in the body and In…

Q: Which of the following is NOT a typical mechanism by which a proto-oncogene is converted to an…

A: Proto-oncogenes are healthy genes that are found in the cell. They play a very important role in…

Q: List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species…

A:

Q: which one of the following statements is incorrect? a. temporal summation occurs when a single…

A: A neuron is a basic unit that serves as a medium for the transmission of a signal (nerve impulse)…

Q: Stem height in Wisconsin Fast Plants is a polygenic trait controlled by 6 genes. In a cross between…

A: Let us assume the 6 genes that control the stem height in Wisconsin Fast plants to be A, B, C, D, E…

Q: Based on today’s science and medicine, when does the age of viability begin? a. between 8 and 12…

A: The viability of a fetus indicates that the fetus has a survival chance. As soon as the fetus…

Q: Ant species work together to collect food and build the mounds they live within. This behavior…

A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…

Q: You are supplied with the following information about a DNA molecule:  The molecular weight of a…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: What is biomass

A: Biomass is defined as the total quantity of plants in a particular area.

Q: In your words explain passive transport by osmosis using isotonic, hypertonic, and hypotonic in both…

A: Osmosis It is passive transport. In this type of transport, the water moves across the semipermeable…

Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…

A: Induction is the process by which the presence of one tissue influences the development of others.…

Q: Which of the following is not true about a gram-positive cell wall? It has plasma membrane inside…

A: Introduction :- The Gram-positive cell wall is made up of many interconnected peptidoglycan layers…

Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…

A: Mimicry refers to the superficial resemblance of two or more organisms that are not closely related.…

Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…

A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…

Q: 13 15 DSS karyotic organisms that cause infections eases that can't be caught (passed from person to…

A: Disease is a state of illness which could be contagious that is spread from person to person or…

Q: You are studying the process of oxidative phosphorylation in the lab. You isolate several…

A: Mitochondria is also known as the powerhouse of the cell.

Q: QUESTION 15 Which of the following does not change gene frequencies in populations? selection O…

A: Introduction :- The relative frequency of an allele (gene variant) at a specific locus in a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.