readEmpFromFile
Q: describe how to setup a switch to monitor traffic passing across its ports.
A: Introduction: Using specialized gear and software, traffic monitoring, also known as network monitor...
Q: Write a python program that create 3 data visualization using the Acquaculture dataset (https://docs...
A: The solution is given below for the above-given question:
Q: What Is A Symbol Table?
A: Symbol Table is an important data structure that is used in a Compiler.
Q: ss file to html.
A: The code along with screenshot. The note-external css is not given with code as it includes several ...
Q: Find the compliment 1 (A+B')C = ?
A:
Q: Q1. Suppose we have a University System. The university has three departments CS, IT and CNET. Each ...
A: code --> ``` import java.io.*; import java.lang.*; import java.util.*; class University { ...
Q: write a JAVA program to input a positive integer from the user and print true in the output if the n...
A: As per the requirement program is developed. Algorithm: Step 1: Write the main() method Step 2: Ask ...
Q: Write a C++ program to take an array of ints, print true if the sequence of numbers 1, 2, 3 appears ...
A: Required:- Write a C++ program to take an array of ints, print true if the sequence of numbers 1, 2,...
Q: What are the primary areas of conoern for risk management, and how wwould you define them?
A: the answer for below question is: Risk management is the process of identifying, evaluating and mana...
Q: Create a class named "Manager". This class has two private attributes: Salary, Address. You want to ...
A: Below is the program implementation for above question in Java. NOTE: The main method acts as driver...
Q: Differentiate between two widely utilised system development techniques. What are the key advantages...
A: The question is differentiate between two widely utilised system development techniques and what are...
Q: What function do design patterns play in software engineering, and how may they be effectively appli...
A: A design pattern is a generic, reusable solution to a problem that often arises in software developm...
Q: What is the command "make" and the file "Makefile" ? can you execute the o program without prefixing...
A: The make command has a lot of built-in knowledge, it can’t know how to build your application all by...
Q: data Ox00000000 c byte 1.2.3,4.5 occupy(1)memory units(B) s haf 1.2.3,4.5 occupy Cs asciz hello worl...
A: What is the memory map of the data segment? 1. Text fragment 2. Instated information section3. Unini...
Q: Discuss the trade-offs of using a database-independent API such as PDO in comparison to using a dedi...
A: PHP Data Objects(PDO) provide methods for prepared statements and working with objects that will mak...
Q: Define the term "applet."
A: Applet An applet is a special type of program that is embedded in the webpage to generate dynamic co...
Q: Write a C++ program to take an array of ints, print true if the sequence of numbers 1, 2, 3 appears ...
A: C++ Program: #include <iostream>using namespace std; /* sequence() function of boolean type fo...
Q: Exercise No.1 Create an algorithm, flowchart and progra 1. Ask the user to input two integers 2. Mul...
A: Algorithm for addition, subtract, multiplication, divide - 1- Declare variable (Two variable for sto...
Q: Why were timers required in our rdt protocols?
A: Introduction: Reliable data transmission protocols (RDT, RDP) are algorithmic procedures that give r...
Q: ii) Input a string single from the user and form a string triple in which all characters of the stri...
A: This program can be done by using strings concept in java.
Q: Determine the difference between the phrases appliance and device. Give specific instances for each.
A: Introduction: The device in issue has a very particular purpose, according to the query. You'll be t...
Q: What exactly is Assembler?
A: Introduction: Assembler: An assembler is a type of computer program that interprets software program...
Q: I am a student in a deep learning class. Q1. We want to use a 1-layer NN for MNIST classificatio...
A: from numpy import loadtxt from keras.models import Sequential from keras.layers import Dense # load ...
Q: Make a speech why online game should be considered a sport
A: Let's see the solution
Q: C language 3. Develop a complete program that consists of three function name as triangle, rectangle...
A: As per the requirement program is completed. Algorithm: Step 1: Write the main() method Step 2: By u...
Q: Write a Java program to print the given pattern: GHIJ DEF ВС
A: Java is one of the languages, which is considerably used in many sectors of Computer. In older time...
Q: What examples of Python rules and methods can you provide?
A: Introduction: Note: Python's syntax rules and rules for defining methods are discussed in the follow...
Q: Apex Assignment: Create a apex class called addition and then create a method to add the 2 integer a...
A: The main contents of a LWC are also html, javascript. There are optional content like css. But then ...
Q: What happens if the referential integrity of your database is not enforced? What types of mistakes a...
A: Introduction: Enabling referential integrity for a table connection is a great way to do so.
Q: anaged Services provided by bigger providers? What are the advantages that they expect to get from d...
A: Why do companies desire to hire Managed Services from larger companies? Every company employs techn...
Q: Explain why GPS receivers are included in cellphones and what they are used for.
A: Introduction: The Global Positioning System (GPS) is the United States-owned service that delivers p...
Q: The question is, how do you handle security in an office that has shared resources, such as a printe...
A: Introduction: Resources that may be accessed by several distant computers linked via a local area ne...
Q: Given the fact that the globe is running out of IP addresses, what is likely to happen with IP addre...
A: Introduction: From small to big businesses, there were often more computers than IP addresses availa...
Q: give a randomly ordered array of n elements; partition the elements into two arrays such that the el...
A: We need to write a C program for the given scenario.
Q: The simplest method for resolving word problems.
A: Answer: Students are typically perplexed by word problems since the question does not appear in the...
Q: I am super confused at why nothing is being accepted when I submit my work for a check. This MindTap...
A: The error that is coming is that it says a table named REP already exists in the database.
Q: Computer Science Part 2: Client Program with ArrayList Create a second client program. This program ...
A: Program: import java.util.ArrayList;import java.util.Random;import java.util.Scanner; class StudentG...
Q: Computer Science The draw selection method implementation does not create a dashed box. Instead it ...
A: The concept that could be used over here is overloading.
Q: Given an ordered array of n elements, partition the elements into two arrays such that the elements ...
A: We have an ordered array of n elements. We need to write a program that will make a partition of thi...
Q: Write a Java program to take a string from user, print a string made of the chars at indexes 0,1, 4,...
A: I give the code in Java along with output and code screenshot
Q: Why is it a good idea for a server to establish threads to handle requests from clients?
A: Introduction Why is it a good idea for a server to establish threads to handle requests from cli...
Q: Construct the digraph of a Moore machine with five different states that has input elements a, b, an...
A: Given: Input elements a,b and accepts the input strings end with baba.
Q: The Municipality of Muscat collects and retains a large amount of information on its everyday operat...
A: Introduction: Master data incorporates information from the Muscat Municipality's many departments, ...
Q: 1. What's "Bayes Decision Rule"? Explain with presenting formula(s) for a hypothetical two-class exa...
A: Bayes Decision Rule
Q: What distinguishes hashing passwords stored in a file from having an encrypted password database?
A: Introduction: Before sending data via a network, it is critical to ensure its security. It safeguard...
Q: What is the procedure for recovering data from a solid state disk in a forensically sound manner?
A: The procedure for recovering data from a solid state disk in a forensically sound manner is as foll...
Q: Given a string str and number n, write a program in JavaScript that recursively appends a copy of st...
A: CODE: function RecuriveCopy(strInp, num) { if (num <= 0) { return strInp; } ...
Q: Acne is a very common skin disorder ___ most young people get in early adolescence a) O for whic...
A: Let's see the solution
Q: What is the role of intrusion detection and prevention in network security and cybersecurity?
A: Introduction: An Intrusion Detection System (IDS) is a program that monitors network traffic for sus...
Q: How do you verify that each machine in an IPsec network utilises its own private key pair if you're ...
A: The Internet P Security Architecture (IPsec) gives cryptographic insurance to IP datagrams in IPv4 a...
My question below
Implement a function readEmpFromFile that takes a FILE * as the only argument and returns a pointer to a struct employee. This function should read the information from the file (reversing what writeEmpToFile does), create a new employee and fill in the data. If the FILE has no more info (is at end of file), this function should return NULL. This function must also ensure any employee actually created (not the NULL) is added to the array (as is done in createEmployee).
The function called readEmpFromFile this function is different and should not to be mistaken with the function called readEmployee
Each of these functions does something different than one another
Change main to load employees from a file using a command called LOAD which is given to the program using (using your readEmpFromFile function you just wrote).
https://onlinegdb.com/jYuB3gpCx
Step by step
Solved in 3 steps
- My Question starts here In the code linked Implement a function readEmpFromFile that takes a FILE * as the only argument and returns a pointer to a struct employee. This function should read the information from the file (reversing what writeEmpToFile does), create a new employee and fill in the data. If the FILE has no more info (is at end of file), this function should return NULL. This function must also ensure any employee actually created (not the NULL) is added to the array (as is done in createEmployee). Change main to load employees from a file if a command line argument is given to the program (using your readEmpFromFile function you just wrote). Question ends here To make it easier so that you do not have to go through the entire code I'm going to put writeEmpToFile function right here after the question but if you still need to look at the full code to get an understanding of what you are working with its linked at the bottom void writeEmpToFile(Employee *emp, FILE…PROGRAM IN PLAIN C PLEASE! Write a void function that will merge the contents of two text files containing chemical elements sorted by atomic number and will produce a sorted file of binary records. The function’s parameters will be three file pointers. Each text file line will contain an integer atomic number followed by the element name, chemical symbol, and atomic weight. Here are two sample lines: 11 Sodium Na 22.99 20 Calcium Ca 40.08 The function can assume that one file does not have two copies of the same element and that the binary output file should have this same property. Hint: When one of the input files is exhausted, do not forget to copy the remaining elements of the other input file to the result file.Write a void function that will merge the contents of two text files containing the chemical elements into a single binary file. The function's parameters will be three file pointers; each text file will contain an integer atomic number followed by the element name, chemical symbol and atomic weight. Here are two sample lines: 11 Sodium Na 22.9920 Calcium Ca 40.08 The function can assume that one file does not two copies of the same elements and that the binary output file should have the same property. IN C PLEASE
- In c++ creates a function checkWord that:1) uses an input file stream to read input file (file1) containing correctwords from the English dictionary into a proper STL container.2) uses an input file stream to read another input file (file2) containinguntrusted English.3) Words that we need to check its correctness against the trusted filefrom the dictionary.4) Prints the incorrect words in file2 after checking it against file1.5) If there are no incorrect words, the function should print “All wordsare correct”.Implement a function writeEmpToFile that takes two arguments: a struct Employee pointer and a FILE *. It should write each field in order as an appropriate type. Note that you will probably want to write a length of the name before you write the characters of the name. By doing this, when you write the load function below, you can read the length of the string and use it to malloc a buffer of the proper size to hold the name. Because of the embedded name pointer, you CAN NOT write the Employee struct as a single struct. You will need to write it out field by field. You will want to write this as a binary file, not as a text file. Implement a SAVE command in your main loop that will save all the employees out to a file. The SAVE command should ask for a file name, similar to the way your FIND command asked for a name. Below is the work I have done so far that is required from the image but I have not been able to finish it and I need assistance with making the final changes that…In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
- Each line of a hockey file contains a four-digit year, a team name, and a two-digit number of wins.Here is one such file, hockey.txt:2003maple leafs452020maple leafs351995senators181996maple leafs302000senators482012canadiens48The first line of the file, for example, says that in 2003 (year), the maple leafs (team name) had 45 wins.Write a function that takes an open hockey file and returns a list of tuples,where each tuple refers to a team name and that team's maximum number of wins in any year.Here is a sample call of the function on hockey.txt:>>> teams_and_most_wins(open('hockey.txt'))[('maple leafs', 45), ('senators', 48), ('canadiens', 48)]"""from typing import TextIOdef teams_and_most_wins(f: TextIO) -> list[tuple[str, int]]:'''f is an open hockey file.Each year has 4 digits and each number of wins has 2 digits.Return a list of tuples where each tuple storesa team name and that team's maximum number of wins in any year.Every team should appear in exactly one of the…Using the Seek() Method in C#In the next steps, you use the Seek() method to reposition a file pointer so you canaccess a file from any location. The user will be prompted to enter a number representinga starting point to list the names in the Names.txt file. Names from that pointforward will be listed, and then the user will be prompted for another selection.1. Start a new program named AccessSomeNames that demonstrates howto access requested names from the Names.txt file you created in theCreateNameFile application.Searching a Sequential Text File using System;using static System.Console;using System.IO;class AccessSomeNames{static void Main(){FileStream file = new FileStream("Names.txt",FileMode.Open, FileAccess.Read);StreamReader reader = new StreamReader(file);Complete the below function that takes the name of two files, inFilename and outFilename as arguments and reads the text from the inFilename. In this file each line contains the Turkish Republic Identity Number (TCNO), name, surname and telephone number of a person. Your function should sort all persons according to their TCNO, write the sorted data into outFilename. If the file inFilename does not exist, then the function must create an empty file named outFilename. For example, if the function is called such as readText("in.txt", "out.txt") and in.txt is as follows: ===== in.txt ===== 12345678904 Barış Manço 0555-999-99-66 12345678902 Ahmet Kaya 0555-999-99-88 12345678901 Burkay Genç 0555-999-99-99 12345678903 Erkin Koray 0555-999-99-77 ================== Then, the function writes the sorted information into "out.txt" as follows: ===== out.txt ===== 12345678901 Burkay Genç 0555-999-99-99 12345678902 Ahmet Kaya 0555-999-99-88 12345678903 Erkin Koray 0555-999-99-77…
- Do not copy paste from any source else downvote Write a void function that will merge the contents of two text files containing chemical elements sorted by atomic number and will produce a sorted file of binary records. The function’s parameters will be three file pointers. Each text file line will contain an integer atomic number followed by the element name, chemical symbol, and atomic weight. Here are two sample lines: 11 Sodium Na 22.99 20 Calcium Ca 40.08 The function can assume that one file does not have two copies of the same element and that the binary output file should have this same property. Hint: When one of the input files is exhausted, do not forget to copy the remaining elements of the other input file to the result file.The following Python code is a partially written function that attempts to read a file's contents into a dictionary. Fill in the missing code in the make_dictionary function. You do not need to copy any of the existing code. Just write the code that would go in place of "YOUR CODE HERE". def make_dictionary(filename):'''Function -- make_dictionaryCreates a dictionary from a file's contents. Each line in the file is split into a list at commas.If, after splitting, the list contains exactly 2 parts,the first item is added to the dictionary as a keyand the second item is the value. If the providedfile doesn't exist, the message "File doesn'texist" is printed to the terminal and anempty dictionary is returned.Parameter:filename -- The name of the file to open.Returns:A dictionary of the file's contents, if thefile matches the expected format. Otherwise, anempty dictionary is returned.'''contents = {}# YOUR CODE HEREreturn contents Example If the contents of the file passed to the function…