Q: What do Target tissues for cytokines includes?
A: Target tissue or cell is the category of cells that are harmonizing with the peculiar hormone molec...
Q: Suppose a person had an unusual mutation in the troponin protein of his skeletal muscles, such that ...
A: The muscular system is a system of muscles where muscles are connected to bones and also to envelope...
Q: Order the images below in the correct sequence using the drag an drop feature.
A: Ans: The order of given stages of mitosis will be as follows: 4, 2 3, 1
Q: please help me answer these 3 questions. thank you! 1. at what stage of mitosis can be the kind and ...
A: Mitosis is an equational division. It produces two daughter cells. These daughter cells are identica...
Q: 2. How different would your DNA be if you had an identical twin? 3. Imagine that you are a forensic ...
A: Identical twins are also known as monozygotic twins. They result from the fertilization of a single ...
Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA that i...
A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in so...
Q: Diagram of portion of lung lobule. and Bronchial tree branching
A: NOTE:- As you have posted two diagrams, we will solve the first part for you, to get the remaining s...
Q: What "Seven Wastes” can be observed in a governmental agency? How could improvements be made for eac...
A: To be specific, an understanding of the “Seven Wastes” is needed before they can beidentified and el...
Q: 3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this se...
A: 7. In all living organisms, the material that contains the information which is transmitted from o...
Q: What is the term for the epithelium of the endocardium and epicardium
A: Epithelium is the major tissue out of four animal tissue. It is thin, protective and continuous lay...
Q: (1) Convert the temperatures -30 °C, 10°C, and 50°C to Kelvin and Fahrenheit.
A: The degree of hotness or coldness of an object is known as temperature of that object. It can be me...
Q: Science thanks for toot help
A: Animals have body structures, physiological and behavioural responses to the changing environmental ...
Q: What did Henry Dale do?
A: Sir Henry Hallett Dale OM GBE (9 June 1875 – 23 July 1968) was an pharmacologist and physiologist.
Q: The relationship between amino acids and polypeptides is similar to the relationship between triglyc...
A: Three macronutrients are required by the body for the normal functioning and it is consumed through ...
Q: could you please enumerate one by one the PPE (personal protective equiments) needed when fabricatin...
A: Medical personal protective equipment generally involves protection for the face such as goggles and...
Q: Another source of phosphorus in water is known as organic phosphorus which commonly finds its way in...
A: Ans: true
Q: The ABO blood type locus has been mapped on chromosome 9. A father with blood genotype BO blood and ...
A: The presence or absence of the antigens A and B, which are borne on the surface of red blood cells, ...
Q: -Complete the table by filling up the necessary details. -It's not incomplete. - Thank you in advanc...
A: Pls find the answer below: ...
Q: Which component(s) participate in bonds that form the tertiary structure of a protein? Select all th...
A: Proteins are polymers of amino acids. The amino acids are connected by a peptide bond. Primary, seco...
Q: Explain how in some cases a single nucleotide change in a DNA sequence can have very detrimental eff...
A: Mutations is the sudden heritable change in the make up of gene. Mutation basically occur by inserti...
Q: --As glucose is split in the cytosol of the cell, is there a release of carbon dioxide as by-product...
A: Glycolysis occurs in the cytosol of the cell whereas the Krebs cycle and oxidative phosphorylation o...
Q: What is the role of calcium ions in a chemical synapse?
A: Calcium ions play important role in a chemical synapse as calcium ions trigger the release of neurot...
Q: Biology Question
A: Diffusion is a direct, unaided movement of a solute from a region where its concentration is higher ...
Q: a.A specles describes the series of lifetime events, including how resources are used for growth, ma...
A: A species is defined as the group of living organisms that can able to reproduce with one another an...
Q: -How many metabolic pathways are present in aerobic respiration?
A: metabolism is the process which involves modification of chemicals for transfer of energy and other ...
Q: Use the image to answer the question: 1a. Are B and C monophyletic, paraphyletic, or polyphyletic? E...
A:
Q: Biology Question
A: D - Cytokinesis Phases X, Y, Z are all part of Cytokinesis
Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce ...
A:
Q: Which of these is a scalar quantity?
A:
Q: Based upon stimulus origin, would a cutaneous pain receptor beclassified as an exteroceptor, an inte...
A: A stimulus is a broad term used for many signal from inside and outside that provoke various recepto...
Q: What is the time relationship between a skeletal muscle fiber action potential and the resulting con...
A: A skeletal muscle is a part of the “muscular system” of our body. A fiber of a skeletal muscle is cy...
Q: Heat exchange with the environment depends on the surface area-to-volume ratio of the body. Assuming...
A: Heat retention, absorption, and loss can all be influenced by body shapes (surface to volume ratio),...
Q: An inherited trait that is expressed even when inherited from only one parent
A: DNA is the genetic material of the the organisms like plants and animals. DNA is a double helical st...
Q: cely to be frightened away by a brightly colored tail.
A: The tail of the animal can serve many important function. They are mainly used in balance and locomo...
Q: Use the image to fill out the missing information on the lines.
A: Diatoms forms the major group of phylum algae especially microalgae. They inhabit oceans, waterways,...
Q: you have a plant that is struggling to survive. after closer examination you notice tiny red mites a...
A: Introduction An ecosystem deals with both biotic and abiotic factors and their interaction with eac...
Q: -Among the metabolic pathways of cellular respiration, which phase is the major contributor of ATP?
A: Cellular respiration is a process that in turn assembly of three especial metabolic pathways: glycol...
Q: Define the term sensory transduction?
A: Senses like touch, taste, vision, pain, temperature, etc all are felt when we receive some stimulus ...
Q: How many of the results below are from the action of gastric juice ? -bacteria cells are destroyed ...
A: Gastric juice contains hydrochloric acid ( HCl) and some enzymes. HCl is secreted from parietal cell...
Q: What are the different stages of the follicular phase of the menstrual cycle taking place in ovary a...
A: The menstrual cycle includes the changes that occur in the ovaries and uterus of a reproductively ma...
Q: In which part of the central nervous system is the substantia nigra located?
A: The substantia nigra is a motor nucleus of the brain that is plays a major role in movements of musc...
Q: Why is NSS preferred over water in preparing fecal smear?
A: Introduction: Normal saline is a crystalloid liquid that is an aqueous solution of electrolytes and ...
Q: Physiological processes have optimal conditions for functioning, and outside of that optimum, enviro...
A: Smaller physical and chemical reactions take place at various levels and these physiological mechani...
Q: Which of the following cell membrane lipids prefers to reside in the INNER leaflet (or inner half) o...
A: A zwitterion is defined as an inner salt which comprises of equal number of positively and negativel...
Q: Where does lymph originate? What propels lymph through the lymphvessels? How is the lymphatic system...
A: Anatomy and physiology are the branches of biology, anatomy deals with the study of the structure of...
Q: Explain why those patients who consume drugs to treat Parkinson’s disease sometimes develop symptoms...
A: Parkinson's disease is an issue of the central nervous system that influences movement, frequently i...
Q: Offsprings produced by asexual reproduction are referred to as clones. Why?
A: Introduction Reproduction is the characteristic of all biological species present on the Earth. All...
Q: During which mitotic phases are duplicated chromosomes present? Select one: A. Prophase and anaphase...
A: Mitosis is the cell division process in which a cell divides to form exact the same cell as it was b...
Q: When nucleotides polymerize, O hydrogen bonds form between the nitrogenous bases of two nucleotides ...
A: The backbone of sugar-phosphate forms the structural framework of nucleic acids, as well as deoxyrib...
Q: DNA fragmentation is the separation or breaking of DNA strands into pieces. Why is it important to i...
A: Introduction In the genome there are usually two type of nucleic acid sequence present. One is Non ...
Step by step
Solved in 2 steps
- 41.A55-year-old womanhasaneoplasmoftheanterior bodyofthe uterus.Which of the following structures is most likely to be affected first by contiguous spread of the neoplasm? O A) Bladder B) Fallopian tube C) Ovary D) Rectum E) Sigmoid colonDoes the hypophysis-ovaries endocrine axis work inthe same way duringpregnancy as in non-pregnantwomen? If pregnancy doesnot occur how does anothermenstrual cycle begin?The conceptus, upon reaching the uterus, first ________. implants divides disintegrates hatches
- A seminiferous tubule of the testis is lined with__________ epithelium.a. simple cuboidalb. pseudostratified columnar ciliatedc. stratified squamousd. transitionale. stratified cuboidalIn male reproductive system, thetestes are situated outside the abdominal cavity within a pouch called __________.A. GlandsB. ScrotumC. Testicular LobulesD. Seminiferous Tubules1. Female reproductive system