This trace element is essential and required at the lowest levels in plants, and therefore deficiencies are very uncommon. It is involved in nitrogen assimilation. Select one: a. Mo b. Ni c. P d. Mg e. N

This trace element is essential and required at the lowest levels in plants, and therefore deficiencies are very uncommon. It is involved in nitrogen assimilation. Select one: a. Mo b. Ni c. P d. Mg e. N

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter22: Prokaryotes: Bacteria And Archaea

Section: Chapter Questions

Problem 3VCQ: Figure 22.19 Which of the following statements about the nitrogen cycle is false? Nitrogen fixing...

See similar textbooks

Related questions

Q: Describe how HpaII and MspI can be used to determine if a given DNA sequence is methylated. Any…

A: HpaII and MspI are two useful enzymes used to detect methylation in a given DNA sequence. These…

Q: Which of the following statements about metabolic heat is true? A. All animals produce metabolic…

A: Metabolic heat is the heat produced by an organism's cells as a byproduct of cellular respiration.…

Q: 50 divisions 1 division um

Q: Which of the following is not a plausible explanation for the fact that the possibility of evolution…

A: Evolution is the process of change in the inherited characteristics of biological populations over…

Q: Because of the mechanism of sex determination, males of many species can be neither homozygous nor…

A: * When one or more genes present they will together produces the effects qualitatively which is…

Q: Neurogenesis refers to the formation of new O thoughts synapses cells memories

A: Introduction: Neurogenesis: The process through which neural stem cells generate the neurons , the…

Q: What if the wall of the urinary bladder contained skeletal muscle? Be sure to discuss how the…

A: Introduction The urinary system is one of the important organ system in our body. The main function…

Q: What are the purposes of pre-cooling of food commodities? Compare air cooling and water cooling…

A: Food preservation methods are techniques used to extend the shelf life of food and prevent spoilage.…

Q: Because stimulation and experience are key in strong brain development, infancy is often referred to…

A: Introduction :- Infancy is the earliest stage of childhood, typically defined as the first year of…

Q: 4. Choose two of the five following statements about natural selection and provide a specific…

A: Natural selection is a mechanism of evolution that results in adaptations being favored or selected…

Q: Childhood malnutrition is associated with which long-term effect? cognitive deficits obesity anxiety…

A: Children who are malnourished may be small for their age, thin or bloated, listless, and immune…

Q: Sex-limited inheritance is the same as sex-linked inheritance. O True O False Submit Request Answer

A: Inheritance is the process by which traits or characteristics are passed from one generation to the…

Q: Explain in 4-5 sentences, what could be the significance of the ability of flowering plants to…

A: Introduction : Fruits and seeds are formed through fertilisation. In angiosperms, double…

Q: What are functional groups? Define monomer and polymer? What molecules are composed of polymers? How…

A: * Functional group is a part of a molecule which is recognizable or classified as group of bound…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: The key structural difference between DNA and RNA is O RNA is a protein, while DNA is a nucleic acid…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule that stores and transmits genetic…

Q: 6. Identify the following functional groups AND provide an example of one biomolecule containing…

A: Introduction Biomolecules are organic molecules that are found in living organisms and are…

Q: Name and briefly describe three major contributions that Dr. DeBakey made to medicine and biomedical…

A: Dr. Michael DeBakey was a pioneering American heart surgeon and medical researcher who made numerous…

Q: In bypass surgery, the cardiovascular surgeon will collect a portion of the living saphenous vein…

A: Introduction The cardiovascular system, also known as the circulatory system, is a complex network…

Q: Cite some measures to preserve the integrity of laboratory results

A: Introduction Laboratory methods refer to the techniques and procedures used in a laboratory setting…

Q: Create a Cladogram using the traits from the table. Give a reason why you placed each organisms…

A: We have to create a cladogram based on the tabular information given in the question.

Q: Chapter 6- The Cell Describe the detailed structure of all eukaryote organelles. What is the…

A: Eukaryotic organelles are specialized structures within eukaryotic cells that perform specific…

Q: What are the differences stratification among animals (birds, mammals, frog, reptiles

A: In ecology, stratification refers to the vertical stacking of habitat and the layering of plants. It…

Q: Pigeon color coat is determined by one autosomal gene with two alleles Y and y. Where Y is blue…

A: Introduction Alleles are different versions of the same gene. Each gene typically has two alleles,…

Q: Explain well the principle behind the streak plate method.

A: In microbiology, there are two types of cultures, pure culture and mixed culture. In pure culture,…

Q: Peptide 1: QAMGRAGDLKYLGLHSV Peptide 2: ALMALFMVMALVLVSVLFIA Peptide 3: MVEDLLKQIARYLISE Which of…

A: The structure of proteins is a key factor in determining their function. Peptides, which are short…

Q: Assume there is a population with these different percentages of genotypes: 68% BB, 20% Bb, and…

A: According to Hardy Weinberg equation p2 + q2 + 2pq = 1 and p + q =1 Where p = frequency of the…

Q: What physical and chemical methods could break the chain of infection?

A: Introduction : The spread of an infection throughout a community occurs in a series of connected…

Q: What are the differences stratification among animals (birds, mammals, frog)

A: Introduction Stratification refers to the way organisms are organized into different levels of a…

Q: For the follow sets of parents, give what blood types are POSSIBLE. Parent 1 B+ A- O+ A+ O-…

A: Blood groups are classifications of blood-based on the presence or absence of certain antigens on…

Q: Question 4 If a cell signaling pathway contains negative feedback, as the pathway is activated it…

A: Introduction Negative feedback is a mechanism in which a response to a change in a system is used…

Q: Please comment on the status/development of long-term food storage facilities in Quebec, Canada.…

A: Food storage is the practice of preserving food for future use. Proper food storage techniques can…

Q: Syt1 point mutation is a point mutation in synaptotagmin-1. A. How did the experiment shown in the…

A: Synaptotagmin-1, a protein that detects calcium ions at synapses, collaborates with the SNARE…

Q: Which is true of habituation? It occurs during infancy only. The effects of the stimulus decrease…

A: Introduction :- Habituation is a form of learning in which an organism's response to a stimulus…

Q: List four ways in which fiber is beneficial to the human body. Give a 2-3 sentence explanation for…

A: Introduction Nutrition is the study of how food affects the body. It involves understanding how…

Q: True or False? 1. The 5’ carbon in a nucleotide is a part of the nucleic acid backbone’s…

A: A nucleotide is formed of a pentose sugar, a phosphate and a nitrogenous base. Each nucleotide is…

Q: The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a…

A: Introduction :- In molecular biology, a promoter is a region of DNA that initiates the transcription…

Q: Please label the following: (A) INITIATION *Complementary strand *Template Strand *RNA polymerase…

A: The transcription process is shown in the following diagram. Where DNA is transcribed into RNA with…

Q: What structure is at the core of how all senses “sense” the environment?

A: Introduction :- The senses are the physiological capacities of organisms that provide data for…

Q: What are the major types of hormone structures? Provide two examples of each.

A: Introduction: The body's various systems and organs must work in harmony to preserve homeostasis.…

Q: What is the difference between the light microscope, scanning electron microscope and transmission…

A: Note: According to bartleby guidelines only first question is to be answered. So please upload…

Q: 1. If there was a negative charge at Ser 80 or Lys 84 which amino acid could be switched out and…

A: Amino acids are the building blocks of proteins and are joined together by peptide bonds. In a…

Q: what are the similarities and differences between SNOMED CT and CPT.

A: A medical coding system is a standardized method of assigning codes to medical diagnoses,…

Q: In a cloning experiment a fragment of DNA is ligated with a vector such as a plasmid. Following the…

A: The transformation step is an important part of cloning experiments because it helps us get the…

Q: Ribosomes on the surface of the rough endoplasmic reticulum are ? In eukaryotes transcription takes…

A: Ribosome are the single membrane bound organelle found inside the cell.They help in the translation…

Q: What process best characterizes Ca2+ movement from the cytosol (low Ca2+ concentration) into the…

A: The plasma membrane or cell membrane acts as a barrier that separates the internal and external…

Q: Define the words “Emerging Virus” and “Pandemic”. Give examples of human diseases caused by viruses.…

A: Virus: A virus is an infectious submicroscopic creature that only reproduces inside of live cells.…

Q: Describe the main parts of a virus. Why are viruses called parasites? Describe the lytic cycle of a…

A: A virus is an infectious submicroscopic organism that only reproduces inside of living cells. All…

Q: What is the difference between a gene and an allele?

A: Gene: A gene is a segment of DNA that contains the instructions for the production of a particular…

Q: Production of epinephrine and norepinephrine by the adrenal medulla is controlled by the___?…

A: The production of hormones such as epinephrine and norepinephrine by the adrenal medulla is an…

Concept explainers

Soil Ecosystem

Soil provides a habitat or living environment for a large number of different species of organisms as well as plants. It provides all the essential nutrients and minerals for plants to grow. All these together form the soil ecosystem.

Question

This trace element is essential and required at the lowest levels in plants, and therefore deficiencies are very uncommon. It is involved in nitrogen assimilation.

Select one:

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

Step 2 Answer

Step 3

Step 4 Conclusion

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe the movement of an atom of nitrogen from the leaf of a plant, through the process of decomposition, and back into the root of another plant.
In the nitrogen cycle the Assimilation process is a metabolic reaction: anabolic, catabolic, endergonic, exergonic, heterotrophic or autotrophic.
For an element to be regarded as essential, all of the following criteria must be met, except: a. No other element can perform the function. b. The element is directly involved in plant nutrition. c. The element is inorganic. d. The plant cannot complete its lifecycle without the element.
Regarding nitrogen fixation, are the following statements True or False? a) Atmospheric nitrogen is reduced to the biologically useful form NH3 (or NH4 ). b) Nitrogen fixation in nature and in the lab requires a metal cofactor or catalyst. c) The availability of fixed nitrogen limits biological productivity. d) Ammonium from the atmosphere is fixed to more usable forms of nitrogen, such as nitrite (NO2–). e) Nitrogen fixation is energetically neutral, using a negligible amount of ATP. f) The enzyme nitrogenase, which takes part in nitrogen fixation, is inactivated by oxygen.
A study in wheat fields showed that high levels of carbon dioxide in the atmosphere impair the absorption of nitrate by plants. Consequently, the nutritional quality of these foods may decrease as the levels of carbon dioxide in the atmosphere reach estimates for the coming decades. In this context, the nutritional quality of the wheat grain will be modified primarily by reducing which element?
Explain the role of the following enzymes in feed industry:(a) Phytase (b) Tannase (c) Amylase
An experiment was conducted to determine the deficiency symptoms of tomato plants placed in a hydroponic solution. Six bottles were prepared, and each bottle, except for the positive control, lacked a certain micronutrient. In the positive control, all nutrients were provided. Unexpectedly, the control setup still showed symptoms of micronutrient deficiency. It was then discovered that the relative humidity in the room was very high and transpiration was affected. Explain the appearance of these symptoms in the positive control set-up in lieu of the importance of transpiration? How will thermoregulation of tomato plants be affected if transpiration will not occur?
Describe the Haber-Bosch process to make fertilizers and the relative amounts of fixed nitrogen it produces.
Nitrogen is available to terrestrial plants in the form of Select all that apply. Select one or more: a. nitrite ions in the soil b. nitrate ions in the soil c. animal carcasses d. N2 in the atmosphere e. ammonium ions in the soil
Which of the following is true regarding plants and the nitrogen cycle? a. Nitrogen is a micronutrient b. Nitrogen is used for regulation of ion channels c. None of the above are true d. Nitrogen gas is fixed directly by plants e. Plants use fungi to fix nitrogen
Explain why the anammox reaction is important to the global flux of nitrogen
Camellia and azalea are plants that produce yellow leaves, which is considered an undesirable outcome, when they are grown on alkaline soil. Which of the statements below support the fact about camellia and azalea stated above? a. Loam soil is not advisable to be used in growing camellia and azalea because of its acidity. b. Camellia and azalea should not be planted in chalk soil. c. Camellia and azalea produced yellow leaves because they are planted in acidic soil. d. Camellia and azalea require chalk soil to counter the effect of the alkaline soil used.