Question
Asked Jan 21, 2020
13 views

Threats on biodiversity are synergistic. This means

check_circle

Expert Answer

Biodiversity means the variability among living organisms in the earth from all sources such as terrestrial, marine and aquatic ecosystem. It is generally a measure of variation at vario...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.

Related Biology Q&A

Find answers to questions asked by student like you
Show more Q&A
add
question_answer

Q: Please Help me

A: All the individuals of a group that consists of common ancestors are considered as monophyletic grou...

question_answer

Q: Why is the lifetime of second messengers so crucial to signaling efficiency? Example: Genetically en...

A: Secondary messengers act as mediators of information between cell-surface receptors and effector mol...

question_answer

Q: Cortisol - For the hormone Cortisol (in humans) what is; 1. the origin (gland that secretes the horm...

A: Hormones are chemical messengers or signaling molecules that are produced by the ductless glands and...

question_answer

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGC...

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not mentione...

question_answer

Q: What are at least three ways Central Dogma ( gene expression) is  different in eukaryotes verss prok...

A: Central dogma of life involves three processes namely replication, transcription, and translation. R...

question_answer

Q: It is well known that sphingomyelin interacts with cholesterol and high affinity. What do you suppos...

A: Cholesterol interacts with glycosphingolipids in the plasma membrane to form freely floating aggrega...

question_answer

Q: 5.) You have identified a mutant with the following phenotype:  a) Explain what has most likely happ...

A: Mutation is the alteration in all of part of a DNA of an organism causing the increased or decreased...

question_answer

Q: What is hemoglobin? Why is it important to the function of red blood cells?

A: Hemoglobin, which is commonly abbreviated as Hb is a type of metalloprotein present in the Red Blood...

question_answer

Q: 9) Describe the steps required to use sequencing DNA to identify your gene of interest after perform...

A: DNA sequencing is the process of finding the sequence of the nucleotides on a particular short lengt...