Q: E.coli was incubated with aeration in a nutrient medium containing two carbon sources provided one…
A: First of all, E. coli can utilize glucose and lactose both as a carbon source. Lactose is a…
Q: To brachiate is to O move around suspended from branches like a Siamang to leap from tree to tree…
A: Evolution can be defined as the unrolling of nature that brings about an orderly change from one…
Q: Section D. Secondary Tissues and internal Structure of the Stem (WYNETH) 3. The Woody Dicot Stem…
A: Dicot stem : The dicot plants have a pair of cotyledons, in the embryo of the seeds, hence the…
Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…
A: Muscle tissue is made up of cells that contract when they are stimulated. When the muscle cells are…
Q: 1. Which of the ff is NOT a form of asexual reproduction? A. Budding B. Fission C. Fragmentation D.…
A: Introduction :- In biology, budding is a type of asexual reproduction in which a new individual…
Q: Many amino acid biosynthetic operon under attenuation control are also under negative control.…
A: In bacteria, transcriptional attenuation is a common means of regulating gene expression in response…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: If your 16x concentrated stock solution contains 20g of Nacl per liter, how much NaCI would one…
A:
Q: O Ferquency O haematuria O oliguria
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: Two pea plants with the following genotypes are cross fertillized. RrSsTtVv X RrssTTVv calculate the…
A: A genotype is an individual's gene collection. A genotype is defined as a person's collection of…
Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…
A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…
Q: You are investigating the loss of activity of a particular enzyme in a mutamt bacterium. You…
A: The activity of an enzyme is micromoles of product formed per minute. The enzyme interacts with to…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…
A: Answer
Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…
A: Under anaerobic conditions, yeast uses its nutrition to produce energy. Yeast cells cannot undergo…
Q: 1. Explain the role of Statistics in biological science.
A: Statistics is the science of collecting, analyzing, presenting, and interpreting data.
Q: 2. Why do we use samples in the collection of data?
A: A research proposal is a document that specifies the aims of their research and the techniques that…
Q: How does F1 Plant help farmers? Give atleast 5
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: To relate: "The evolution of natural selection and the evolution of features that reduces the…
A: Natural selection is defined as the physical and reproductive fitness of a species in changing…
Q: pure-breeding yellow (Y) canaries crossed with pure breeding blue (y) canaries make green…
A: Inheritance is the process by which genetic information is passed on from parent to child.
Q: B 1. Name the region of the hair labeled A. 2. Name the structure labeled B. 3. Name the specific…
A: Hair Hair is a thread like strand grow on the skin of the mammals and some other animals.
Q: What are the unifying characteristics of Gnathifera? Are these characteristics present in all…
A: Ahlrichs established the taxon Gnathifera based on morphological data. The Gnathostomulida and…
Q: A cephalosporin that may cause a CU Ceftriaxone O a. O b. Cefaclor O c. Cephalexin O d. Cephamycin
A: Cephalosporins are a type of broad-spectrum, chemically synthesized -beta-lactam antibiotics and are…
Q: How could you prove that the Tn5 insertion was in the lac operon?
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…
A: These are term related to animal diversity.
Q: Fermentation is a strategy used by cells to a. oxidize NADH. b. reduce рyruvate. increase 02 levels.…
A: Introduction :- Fermentation is a metabolic process that uses enzymes to cause chemical changes in…
Q: 5. Which of the following can increase mean arterial pressure (MAP) in an individual? I. II. III.…
A: Given : Mean arterial pressure (MAP) is defined as the average arterial pressure that happens…
Q: 1. Explain the role of Statistics in biological science.
A: Statistics is a part of mathematics that involves collecting data, its study, analysis, and…
Q: n the grouping of cnidarians and ctenophorans in a single phylum before? What were the reasons why…
A: 2. Cnidarians and Ctenophorans are multicellular animals. Both have tissue level of organisation and…
Q: In the following cases of disputed paternity, determine the probable father by writing Father 1 or…
A:
Q: 4. Show a cross for a sickle cell inheritance of a woman who is homezggus, for the disease and a man…
A: Sickle cell disease (SCD) is a group of inherited RBC-related disorders in which the red blood cells…
Q: - Coronary arteries route oxygen rich blood into the tissues of the heart. of the: d. descending…
A: Two major coronary arteries branch off from the aorta. They branch off from a point where aorta…
Q: Give at least 5 observations from the structures based on fish dissection?
A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…
Q: The structure of enzymes that just includes folding and is caused by hydrogen bonding only is called…
A: Introduction The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as…
Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…
A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…
Q: PRIMAL PICTURES 1. Name the nervous system receptor labeled A 2. Name the specific structure labeled…
A: The given image shows the anatomy of the skin. Anatomy of skin: The anatomy of skin reveals that…
Q: Rapidly dividing cells such as bone marrow, skin, intestinal mucosa, and cancer cells need DNA…
A: Cancer is a disease defined by the uncontrolled development of a group of abnormal cells that can…
Q: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…
A: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…
Q: Which of the following Does not describe the juxtaglomerular com Its granular cells produce rennin…
A: In kidney, juxtaglomerular compartment is the key regulator of the functions of each nephrone. It is…
Q: Explain in 2 sentences why Evolution walks a perilous tightrope between continuing and ending.
A: 1. Evolutionary biology is the study of history of different life forms on this planet. Evolution is…
Q: Explain how an excessive input of phosphate ions into a body of water such as a lake can have a…
A: phosphate is a major nutrient needed for life. Phosphate is the most common form of phosphorus, used…
Q: please put (+) if the feature is present and (-) if not. kindly give a short explanation also on the…
A: The pith and cortex of a monocot stem are not separate, whereas the cortex and pith of a dicot stem…
Q: NSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the…
A: The genome of a cell carries various genes that code for one or more proteins. The genes are coded…
Q: Which of the following would apply to desmosomes that are found in cells as they migrate from the…
A: The stratum corneum is the outermost layer of the epidermis and it marks the final stage of the…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: The process of synthesis of proteins from mRNA is called as translation while the process of…
Q: To examine: whether the statement "protein tyrosine phosphatases display exquisite specificity for…
A: Protein phosphatases are the enzymes which are involved in controlling diverse array of processes in…
Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…
A: Abnormal posturing is not the same as "bad posture" or "slouching." Instead, it entails maintaining…
Q: or each of the following genotypes how many gametes would be made? a. AaBb - b. AaBbCC - c.…
A:
Q: To examine: Whether the statement, “The number of c subunits in the rotor ring of ATP synthase…
A: ATP, or adenosine triphosphate, is an organic molecule that provides energy during various metabolic…
Step by step
Solved in 2 steps
- Please answer the density and relative density. Round-off to the nearest hundredth1.options : Energy or matter Mass or volume Time or space 2.options Biomass Energy Numbers 3.options Biomass Energy Numbers 4.options: Biomass Energy Numbers 26. Examine the land use per 100 grams of protein in the data chart below:(image attached)Which of the following statements explains the data trend observed in the chart? Beef uses significantly more land than plants to produce 100 grams of protein. Meat production is more efficient than farming protein from fish and prawns. Lamb and mutton produce more protein per square meters than pig meat and poultry. Nuts and grains produce less protein per square meter than milk and cheese. 52. Which of the following describes the benefits of free-range grazing for meat production? Organic wastes as fertilizer Antibiotic and hormone-free Larger animals Provides quality meat I and II I and IV I, II, and IV I, II, and III 57. Which of the following describes the consequences of overgrazing? Low precipitation Desertification Loss of arable land Soil erosion II, III, and IV I, II, and IV I…
