Transposition is a process in which a discrete DNA entity can move between DNA sites that lack homology using a self-encoded protein called a _______________. Question 2 options: kinase replicase helicase recombinase transposase

Transposition is a process in which a discrete DNA entity can move between DNA sites that lack homology using a self-encoded protein called a _______________. Question 2 options: kinase replicase helicase recombinase transposase

Name: Transposition is a process in which a discrete DNA entity can move bet
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Transposition is a process in which a discrete DNA entity can move between DNA sites that lack homology using a self-encoded protein called a _______________. Question 2 options: kinase replicase helicase recombinase transposase

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Question 35 This enzyme is responsible to cleave the sugar–base bond to delete the modified base, and produce an abasic site during base excision repair Question 35 options: DNA polymerase DNA glycosylase Endonuclease Exonuclease Question 36 Nonhomologous end-joining (NHEJ) repairs DNA lesions that affect both strands Question 36 options: True False Question 37 A DNA variation in which a single nucleotide is changed is called: Question 37 options: Indel Structural variant Single nucleotide polymorphism Copy variant
Which of the following molecules molecule is directly involved in the Methylation reactions and for the successful capping of nascent RNA molecules? Question 32 options: Cysteamine Methionine S-Adenosine-Methionine (S-Ado-Met) Methylamine Homocysteine
Which of the following statements regarding ionizing radiation is FALSE? Question options: pyrimidine dimers are caused by ionizing radiation x-rays are a form of ionizing radiation gamma rays are a form of ionizing radiation electrons are energized by ionizing radiation chromosomal breaks can result from ionizing radiation ALL of these statements are TRUE Question 7 ________ is the first repair system reviewing newly synthesized DNA, and is performed by DNA polymerase III itself. Question options: Mismatch repair Proofreading SOS response Dark repair Light repair with photolyase Base-excision repair
Which enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction? Group of answer choices DNA ligase primase DNA polymerase I DNA polymerase III
Why evenly spaced sequence in chromatogram is an indication of a good DNA chromatogram?
Question 33 Following is the DNA repair mechanism for double stranded DNA damage: Question 33 options: Base excision repair Nucleotide excision repair Homologous recombination Mismatch repair Question 34 This mechanism allows repair of bulky, helix-distorting DNA lesions: Question 34 options: Base excision repair Nucleotide excision repair single strand break repair non-homologous end joining
What structure, found at either end of eukaryotic chromosomes, protects DNA from exonucleases? Question 8 options: Heterochromatin Euchromatin Centromere Telomere
Can you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient. Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands. Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…
Question 43 Following could be classified as mutagens except: Question 43 options: Non-ionizing ultraviolet radiation X-rays, gamma rays White light Harmful chemicals Question 44 Along with modification of histones and positioning of nucleosomes, following is one of the main epigenetic mechanisms operating across the genome: Question 44 options: DNA acetylation DNA methylation DNA oxidation DNA phosphorylation Question 45 Changes in our DNA that have not been corrected by cellular DNA repair systems create: Question 45 options: Transcripts DNA variants Polypeptide Polynucleotide
Which of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Genes are tightly packed in a structure of DNA and histones, known as nucleosomes, that form what structure? Question 28 options: Catalytic unit Chromatin Chromosome Chromatase