Video #2 states that trees can take in CO2 from the atmosphere and store it in wood of the trees as they grow, but video #2 does not provide any evidence to support this statement.

Q: 1. 2. 3. 4. 1. Label the names of the enzymes and the DNA strand indicated in the following diagram…

A: Enzymes play a crucial role in DNA replication. DNA polymerase is the main enzyme responsible for…

Q: which products of the light independent reactions are used by the light dependent reactions

A: Photosynthesis is the basis of the food chain in terrestrial and aquatic ecosystems; it supports the…

Q: s CF respectively?   Punnett Squares “So, what’s next?” asked Mike. “First, we’ll collect DNA…

A: Cystic fibrosis is inherited in an autosomal recessive fashion. This means that when two recessive…

Q: explain the difference between commensalism and mutualism types of interaction .

A: Ecological interactions refer to the ways in which different organisms in an ecosystem interact with…

Q: Explain how meiosis and fertilisation produce variation within a population.

A: There are several factors that contribute to genetic variation in populations. Natural genetic…

Q: The nurse practitioner prescribed 500 micrograms of Risperidone.  The stock solution available in a…

A: Risperidone is an atypical antipsychotic medication used to treat schizophrenia and bipolar…

Q: Why would you be surprised to find the exact same microbial symbionts inhabiting squid and the rumen…

A: To understand the requirements for a successful symbiosis, it is important to consider the specific…

Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…

A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…

Q: Which type of infection is the MOST easily spread to the largest number of people?   Question 3…

A: ANSWER) Gastrointestinal infections spread through the contaminated food and water. Vector-borne…

Q: draw the p21 promoter in a cell with E2F

A: Promoters play a crucial role in gene regulation. They can be activated or repressed by various…

Q: How can you distinguish growth from development?

A: Life starts with a single cell and becomes a complex organism during the course of growth and…

Q: Of the following choices, which types of cells do not have a cell wall composed of carbohydrates?…

A: Cell wall: It is the tough, flexible or (can be rigid) structure that is present just outside the…

Q: 2 Please draw the arrow-pushing mechanism to create the polyketide backbone chain of TYLOSIN. If two…

A: The arrow-pushing mechanism is a type of drawing or method in which the arrow moves from the…

Q: Consider the lac operon of E. coli. Specifically, explain the following: a. Describe the overall…

A: The lac operon is a collection of genes located in the chromosome of Escherichia coli, and it…

Q: What characteristics does a lizard have to adapt to desert wind and dust storms? For example what…

A: Reptiles and amphibians can live in desert environments without suffering from extremities of…

Q: 1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type…

A: The change in the sequence of the genetic material of an organism that results in any heritable…

Q: If the signaling in the mesolimbic pathway is implicated by drug abuse, given what you know about…

A: Introduction The mesolimbic pathway is a neural circuit in the brain that is involved in the…

Q: what might happen to a cell that was damaged by UV light and that has E2 inside the cell

A: UV ray is a radiation that is a form of non ionizing radiation . Which emitted by the sun. It use to…

Q: Micorgnathozoans are characterized by (check all that apply) - dorsal plates -…

A: A class of tiny marine organisms known as Micrognathozoa often measure less than 1 millimeter in…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: uppose that goats have one gene that codes for color, where A is brown and a is white. The goats…

A: Here given, A is brown and a is white,  B is tall and b is short  Parents - AaBb x Aabb   So,…

Q: What is the purpose of an emulsifying agent? List atleast 5 examples used in pharmaceutical…

A: Emulsifying agent An emulsifying agent also called emulsifier refers to a surface-active ingredient…

Q: 8. At the conclusion of the Krebs Cycle, glucose is completely broken down, yet only a net of…

A: The Krebs cycle begins when acetyl-CoA reacts with a four-carbon molecule known as OAA…

Q: Determine the population size of beluga in Canada. Explains with which sample scientific researchers…

A: introduction: The term "canary of the sea" refers to the white hue and variety of vocalisations of…

Q: ompares the processes of diffusion, facilitated transport, osmosis, and active transport.

A: Diffusion, facilitated transport, osmosis, and active transport are the ways by which a cell takes…

Q: Nucleic Acids are polymers made of building blocks called There are two types of nucleic acids. is…

A: Nucleic acids are complex biomolecules. They are of two types RNA and DNA. Among these, DNA acts as…

Q: explain the most likely steps of what might happen inside a MDA-MB-231 cell after it is exposed to…

A: Nowadays cancer is a very common lifestyle disorder.Among females breast cancer is one of the most…

Q: a. State the sizes of restriction fragments that would be generated by each of the following…

A: The sizes of restriction fragments that would be generated by following restriction digestions of…

Q: The genetic diversity of the moss Polytrichum commune was analysed in two peat bog ecosystems.…

A: A species' genetic diversity refers to the variation in its genes and genotypes. It is critical for…

Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) the origin of…

A: DNA is a double stranded molecule. DNA replication is Semi conservative. This means that each DNA…

Q: 4. As an object moves farther away from the eye, how does the lens change to keep the object in…

A: ANSWER) The human has the ability to accomodate the curvature in order to alter the focal length to…

Q: Which of the following techniques would be most appropriate to test the hypothesis that humans and…

A: Natural selection is the process through which populations of living organisms adapt and change.

Q: Define the endosymbiotic theory. Explain how mitochondria and chloroplasts evolved by endosymbiosis.…

A: Life in the world started as a single celled organism. By means of accumulation of mutations,…

Q: Part 1: Briefly describe the levels of organisation within the Human body. You should start your…

A: Organizational levels are natural structures that are typically described by part-to-whole…

Q: Differentiate between aneuploidy and polyploidy

A: Chromosomal variations refer to any changes or differences in the number or structure of chromosomes…

Q: HO ↑ A CH3 B choline head group H3C. C glycerol backbone CH3 CH3 < CH3 B- CH3- CH3 C-CH₂-CH O O C 0…

A: A= Sterol group  B= Choline C = Glycerol D = Acyl chain

Q: 8. Which of the following is the complementary base pairing of the DNA sequence 5' ATTCGGCTTA 3'? a.…

A: DNA replication is the process by which cells create an exact copy of their genetic material before…

Q: D. The is the order of the amino acids held together by peptide bonds which arise from condensation…

A: Proteins are made up of chemical compounds called amino acids. Proteins and amino acids are the…

Q: Which of the following is associated with only the lagging strand during DNA replication? a. RNA…

A: DNA is double stranded which is translated into RNA which then transcribed to form proteins.

Q: Does the atmospheric CO2 level stay the same throughout the year or does it change throughout the…

A: Atmospheric CO2 level majorly depends on the photosynthesis process of plants.

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…

Q: The gastrovascular cavity of cnidarians has two openings, one serves as mouth and the other serves…

A: Cnidaria is a phylum which is under kingdom Animalia that contains over 11,000 species of aquatic…

Q: 2. Which of the following is NOT part of a nucleotide? O Phosphate O Sugar O Glycerol Nitrogenous…

A: As the question contains more than one questions, here we have answered the second question.…

Q: Which cells myelinate the axons of central and peripheral nervous system neurons? Why is myelination…

A: Myelination is a process by which the axons of nerve cells are covered by a fatty insulating layer…

Q: Experiments linking neonicotinoids and declining bee health have been criticized for not simulating…

A: From time to time experiments have been conducted to check the relationship between exposure to…

Q: Compare and contrast life cycles of plants (pteridophytes, gymnosperms, angiosperm), animals, fungi…

A: Life cycles describe the progression of developmental stages that an organism goes through, from its…

Q: 1. On your ovulation chart, mark the unfertile, likely to be fertile, and the most fertile days. Put…

A: Menstrual liquid comprises blood, endometrial cells (uterine lining cells), and mucus. Menstruation…

Q: Differentiate between pro-insulin and mature insulin. Name the commonly used vector for cloning…

A: Insulin is a pancreatic hormone that regulates the quantity of glucose in your circulation at any…

Q: How does pollination take place in water hyacinth and water lily

A: Pollination:  The process of transfer of the pollen grains from the anther which is the male…

Q: How do you sequence a genome and what are the steps involved?

A: ANSWER) DNA sequencing is described as the laboratory process in which the DNA sample is extracted…

Air Pollution

The excess accumulation of pollutants or undesirable alterations in the environment and its resources such as air, water, and land can be referred to as pollution. Pollution affects the components of the environment. Pollution is considered a global issue as it is showing harmful effects worldwide. Metropolitan cities are more impacted by pollution than countryside or villages.