Q: What labels goes to active immunity and passive immunity
A: Immune response is the physiologial process which involves our body immune cells to identify and…
Q: How do you compute maximum electron transport (Jmax) and what does the value tell you about the…
A: Answer : we calculate maximum electron transport (Jmax) by non-rectangular hyperbolic model (termed…
Q: What does your map of cutaneous sensations tell you about the distribution of sensory receptors in…
A: Introduction - Skin - heaviest organ in the body- Protects the organism by keeping damaging agents…
Q: True or false Nociceptors directly detect bacterial pathogens and their products
A: Nociceptors are sensory neurons which are specialized to sense those stimuli which are potentially…
Q: The diagrams represent four possible phylogenetic relationship between the four species: M, L, S,…
A: The phylogenetic tree represents the evolutionary relationship between taxons in the phylogeny. It…
Q: Explain what are the advantages and disadavatges of the CIN, MSI, CIMP pathways and the inflammatory…
A: The Mendelian gene is a basic unit of heredity and the molecular gene is a sequence of nucleotides…
Q: 1. List 3 sustainable practices for a healthy future and healthy environment. 2. Write 3 ways these…
A: 1- Don't throw garbage on street. Always carry a bag for your garbage or throw garbage in public…
Q: 2. On your drawing of glucose, circle and label the hydroxyl groups. What does the presence of…
A: Carbohydrates are polyhydroxy aldoses, ketoses and their derivatives that yield such compounds and…
Q: explain what can be the future developments of curing adenocarcinoma tumours in regard to (colon)…
A: A group of benign (noncancerous) cells collectively known as an adenomatous polyp is the primary…
Q: How do cats drink?
A: Answer : Cats drink water by what we call cat's lapping stratigy.Water stuck to the tip of a cat's…
Q: The type VI secretion system evolved from: please explain and choice the right answer porins…
A: Introduction Bacteria belongs to the kingdom Monera. Bacteria are unicellular and prokaryotic…
Q: When reviewing a Michaelis-Menten Saturation Curve, at first the rate of the reaction is relatively…
A: Michaelias- Menten curve is plotted by taking reaction rate along y axis. The substrate…
Q: During Pavlov's experiment, after many pairings of the sound of the bell and presentation of food,…
A: The term Cognition refers to the ability to acquire, think, process, understand, and remember…
Q: Stomach Which foods are digested here ? Which nutrients are absorbed here ? Which cells make up the…
A: The stomach appears as a J-shaped organ that aids in the digestion of food. Stomach produces various…
Q: What is the importance of MSH1 and MSH2 in regards to adenocarcinoma.( colorectal cancer)
A: MSH1- The msh1 gene is responsible for short life span mutant natural death and functions to…
Q: Illustrate the chromosome changes in interphase and mitosis using a diploid cell that is 2n=4 (two…
A: Mitosis is a type of cell division in which one mother cell divides to produce two new daughter…
Q: The modern human skull is: Select an answer and submit. For keyboard navigation, use th a The one…
A:
Q: Renko studied diffusion of tracer molecules to study paracellular diffusion across an epithelial…
A: The movement of molecules across an epithelium by passing through the intercellular space that…
Q: If a genetic female fetus is exposed to testosterone in utero, would that individual develop a…
A: Men have noticeably more testosterone on average than women, despite the fact that testosterone is…
Q: Draw the Prophase I pairing conformation that would result from this translocation. The four types…
A:
Q: What is different about prophase I and prophase II of meiosis?
A: Cell division is the process through which new daughter cells are formed from the parent cells. It…
Q: B. Let's assume that a small proportion of the homozygote ss individuals do survive and reproduce,…
A: According to the Hardy-Weinberg equilibrium, if no unfavorable forces exist, genetic variation in a…
Q: 1. What are enzymes? 2. Why are they catalysts? 3. How many digestive enzymes does the body produce?…
A: Every living cells perform different activities that keeps the cell alive. Difficult different…
Q: why is the maintenance of homeostasis especially important during development of new umans within…
A: Maintenance of homeostatis is very important in fetuses . The placenta plays a very important role…
Q: Assume that long fingers are Inherited as a recessive trait with an 80% penetrance. Two people…
A: The percentage of people with a specific genotype who also displayed the predicted phenotype is…
Q: Identify 2 or more DNA-based technologies and discuss their combined applications in…
A: We need to discuss the combined uses of two technologies in the generation/development of a DNA…
Q: Perspective on any ethical considerations which engineers should consider when developing code to…
A: A code of ethics is a collection of guiding principles designed to teach professionals how to…
Q: One form of posttranscriptional modification of most eukaryotic pre-mRNAs is the addition of a…
A: Introduction:- Transcription is the synthesis of RNA molecules. After the completion of…
Q: The brain is particularly sensitive to being shaped by input from the environment during sensitive…
A: Developmental psychology is a discipline of psychology that is concerned with the processes and…
Q: Consider a solute having a permeability coefficient of 10-6 m s-1 for the plasma membrane of a…
A: Diffusion is the process of movement of solutes from an area of high concentration to a low…
Q: graduate student wants to isolate cells from a patient and grow them perpetually in culture to study…
A: The correct answers are as follows- A. Telomerase C. MDM2 A graduate student wants to isolate cells…
Q: Small intestine How long is it ? Which segments make up the small intestine? Which foods are…
A: Small intestine is a main part of gastrointestinal tract. It serves for the absorption of various…
Q: "Earth Overshoot Day" is most closely related to which of the following concepts? O A. Carrying…
A: Earth Overshoot Day is a calculated date on which humanity has consumed all the biological resources…
Q: Acetyl Coa is a ____ carbon molecule derived from pyruvate that is used during ______. Select one:…
A: The aerobic respiration process breaks down the glucose into ATP.
Q: The sodium-glucose cotransporter is an example of _____________. The Na/K pump participates in…
A: Cell membrane is being a semi- permeable in nature selectively allows the substance to move in and…
Q: describe the process of mitosis
A: Cell cycle is a series of events the produce parent cell into daughter cells.
Q: Enzymes catalyze chemical reactions by lowering the __________ a. Energy of activation b.…
A: Introduction : The body produces enzymes, which are basically proteins, to carry out specific…
Q: I have a biology, question: In aerobic respiration, energy is harvested from glucose molecules in a…
A: Introduction :- When nutrients are broken down aerobically into carbon dioxide, water, and energy,…
Q: Ozana was born with cataracts, which made her completely blind. When she was 14 years-old she…
A: Neuroplasticity, also known as brain plasticity, is the ability of the brain's biological, chemical,…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: What components are important for making a lipid membrane? please explain the answer and choice the…
A: Cell membrane/ plasma membrane is the curtain that separates the interior portion of cell from the…
Q: Small intestine 1. How long is it ? Which segments make up the small intestine? Which foods are…
A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…
Q: Common OTC medication doses for children are determined by referring to a manufacturer-provided…
A: OTC medicines are Over The Counter medicines which can be sold to a patient without producing a…
Q: The enzymes of the citric acid cycle are located in the a. Inter membrane space of mitochondria…
A: The citric acid cycle is an important metabolic route that links the metabolism of proteins, fats,…
Q: se cats, and they began 7,000 individual months. These eat rodents and ater supplies. hanges in t,…
A: The kit fox is one of a fox species that inhabits arid and semi-arid regions of the southwestern…
Q: The SecB protein helps export proteins by:
A: In molecular biology, molecular chaperones are proteins that help big proteins or macromolecular…
Q: The role of NAD+ in cellular respiration is to move high-energy neutrons during the breakdown of…
A: Oxygen is required for cellular respiration and the metabolism of dietary energy (oxidative…
Q: Where does the following reaction take place: isomerization of the 6-carbon molecule citrate Select…
A: The production of intermediate cis-aconitase converts citrate to isocitrate.This is a reversible…
Q: purple kernel color, while the homozygous recessive genotype causes red kernel color. If corn plants…
A: Given :- Dominant allele Z and recessive allele z Dominant allele cause purple colour and the…
Q: Observe the species in your surroundings, take a picture of the leaves of at least three plant…
A: In given question three type of leaves given of Aloe Vera,organo and Banana leaves. Base is bottom…
Step by step
Solved in 2 steps
- Homeostatic systems regulate the balance between whom?Describe in your own words the important features of homeostasis using the following terms in your explanation: negative feedback, internal environment, receptor, controller and effector.What is Homeostasis, what are the two mechanisms that maintain homeostasis, and provide two examples of events in the body that are controlled and maintained by Homeostasis.