What does cortisol do in the acute response to stress? O Prepares the body for fighting an infection. O Dilates the pupil of the eye to improve vision. O Increase motility in the intenstines O Suppress the immune system

What does cortisol do in the acute response to stress? O Prepares the body for fighting an infection. O Dilates the pupil of the eye to improve vision. O Increase motility in the intenstines O Suppress the immune system

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter31: Endocrine Control

Section: Chapter Questions

Problem 8SA

See similar textbooks

Related questions

Q: Of the following choices, which types of cells do not have a cell wall composed of carbohydrates?…

A: Cell wall: It is the tough, flexible or (can be rigid) structure that is present just outside the…

Q: 5. Why is this decision such a struggle for Suzanne and David? Explain how the implications noted at…

A: Alzheimer's disease is a progressive brain disorder that affects memory, thinking, and behavior. It…

Q: Identify a hormone from the anterior pituitary that is involved in ovum release and briefly describe…

A: The anterior pituitary, also known as the adenohypophysis, is a gland located at the base of the…

Q: Explain the paradox implicit in Bruce McEwen's "allostatic load" concept. How is the concept useful…

A: The allostatic load concept was given by McEwen and Stellar in 1993. According to McEwen and…

Q: explain the steps of what might happen inside a healthy mammary gland epithelial cell after it is…

A: UV light, or ultraviolet light, is a type of electromagnetic radiation with a wavelength that is…

Q: 10) If a person breaths air which is contaminated with a radionuclide at a concentration equal to 1…

A: MPC is the maximum permissible concentration of radionucleotide is the maximum permissible limit of…

Q: Which of the following molecules is more likely to diffuse through a synthetic lipid bilayer (i.e. a…

A: Part A. The protein backbone is the repetitive structure with nitrogen, alpha-carbon and carbon…

Q: Explain the difference(s) that exist between Monocots & Dicots in the Table below: Monocots Dicots

A: Monocotyledons, also known as monocots, are flowering plants (angiosperms) that resemble grass and…

Q: 1. Identify and explain the differences in organelles and energy sources between cellular…

A: Answer : photosynthesis and cellular respiration are two different processes photosynthesis occurs…

Q: 2. The Theory of Endosymbiosis states that: Plant cells are endosymbionts a. b. C. d. The…

A: Endosymbiosis is the theory of evolution of eukaryotes. Eukaryotes have a well partitioned cellular…

Q: estions 1-2: Describe an appropriate control for each of the following. An investigator studies the…

A: In an experiment control is used when the independent variable is removed or set at standard value.…

Q: ompares the processes of diffusion, facilitated transport, osmosis, and active transport.

A: Diffusion, facilitated transport, osmosis, and active transport are the ways by which a cell takes…

Q: 1. 2. Many people believe that forests are net producers of oxygen. However, for net production of…

A: (a). If there were a net production of oxygen gas is in ecosystem, i also expect the glucose, Water…

Q: Curator makes a goo (c) Calculate the enthalpy of combustion for ethanol using bond energies and…

A: Burning some materials at high temperatures is referred to as combustion. A gaseous material (smoke)…

Q: Using the same traits as the previous question, determine the phenotype of an obese mouse that is…

A: In the given case, the genotype of one parent would be “Kknn” and the genotype of another parent…

Q: Which of the following is true about MHC? Check all that apply. A. MHC I is expressed in all…

A: Major Histocompatibility Complex(MHC) is basically a group of genes on DNA.It mainly helps the…

Q: 22. The energy source used in translocation a) ATP b) UTP c) CTP d) GTP

A: A. ATP

Q: 1. Give the names and functions of the following cellular organelles. a. Mitochondria b. Rough…

A: The research of cell structure and function is known as cell biology, and it is based on the idea…

Q: believe is portals of exit because is the route by which an infectious aent leaves the host.

A: Yes, this can be one of the option that can be correct. Droplets, aerosols, saliva, feces, sexual…

Q: LIPIDS: Using three molecules of stearic acid, draw a triglyceride and label the ester linkages…

A: INTRODUCTION =The word lipid is derived from a Greek word "lipos" which means Fat.Biological lipids…

Q: The table shows the distribution of traits (A-E) in six extant species (1-6). A “0” indicates the…

A: Evolutionary biology deals with the evolutionary aspects of organisms. Systematics refers to the…

Q: Define the types of neurons, and give the functions and example.

A: Neurons These are the basic units of our nervous system that is involved in transmitting information…

Q: Explain how cardiovascular, respiratory and gastrointestinal systems ensure that, cells receive the…

A: Cellular respiration is the process in which glucose is broken down in presence of oxygen to produce…

Q: p codon between gal and insulin parts? How do you separate the gal part from insulin insulin part B?…

A: Insulin biochemically, is a hormone and structurally it is composed of two chains that are cross…

Q: With an example, explain how a change in an amino acid can change the structure of a protein.

A: The amino acid sequence of the protein is responsible for generating its 3D structure. A mutation in…

Q: Explain the importance of differential gene expression. Why don't cells and organisms simply express…

A: Gene expression is the process by which a gene's information is used to create a functional gene…

Q: Please draw the mature mRNA that is capable of leaving the nucleus. As you draw this think about…

Q: For a cell: 2N=4 where N is the haploid number of chromosomes. Imagine that this cell is in the G₁…

A: The stages of the cell cycle, including G1, S, and G2, are important in cell division because they…

Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…

A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…

Q: What advantages are there to using plant associated microorganisms rather than animal associated…

A: Microorganisms are essential because they play a role in many ecosystem functioning, such as…

Q: What characteristics does a lizard have to adapt to desert wind and dust storms? For example what…

A: Reptiles and amphibians can live in desert environments without suffering from extremities of…

Q: Which of these describes the symptoms of the disease(s) caused by mutations in KMT2D ? Select all…

A: For a protein participating in a critical biological activity, such as DNA synthesis or cell…

Q: Describe the processes of meiosis and mitosis

A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: create a null hpothesis

A: Hypothesis are an important aspect of statistical analysis. Null hypothesis and alternative…

Q: Design a novel drug for treatment for overactive bladder syndrome which does not target the…

A: Introduction Overactive Bladder Syndrome or OAB is a medical condition in which the ability of the…

Q: What is one of the determining factors in the three-dimensional structure of a protein? A.The…

A: Introduction:- There are different types of bio-macromolecules and bio-micromolecules present in…

Q: Discuss briefly on the purpose of each apparatus: 1. Kymograph 2. Inductorium 3. Signal Magnet…

A: In biology, apparatus refers to the equipment and tools used in laboratory experiments and research.…

Q: 5. Which of the following is considered acellular? Aspergillus fumigatus Mycobacterium tuberculosis…

A: Introduction: All three types of viroids— viruses, virions—are examples of non-cellular life.…

Q: Discuss possible reasons why the density of certain species were more accurately estimated and why…

A: Introduction:- Population consists of all the organisms of a particular species living in a given…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: What term describes the waxy, waterproof coating produced by the epidermis of most plants? a) Hypha…

A: Plants are the multicelluler, photosynthetic organisms which mainly have producers of biosphere.…

Q: Consider three yellow, round peas, labeled A, B, and C. Each was grown into a plant and crossed to a…

A: Introduction A gene exists in two alternative forms called alleles. If both the alleles are same, it…

Q: A reaction that results in the formation of water as an end product: combustion A reaction that…

A: Amino acids are the building blocks of proteins .Amino acids contain both carboxyl and amino…

Q: should be minimum one paragraph explaining statement Groups of organs with specific structures and…

A: An organ is a structure made up of different types of tissue that performs a specific function or…

Q: identify the vegetative propagule of eichormia.

A: Vegetative propagation is the process of asexual reproduction in plants. The process in which new…

Q: B. Write the function/s of each part of the microscope listed below. a. Eyepiece b. Draw tube c.…

A: An instrument, microscope is used to observe tiny objects even cells. It examines the objects that…

Q: In the classic 1994 paper, "Does More Intensive Treatment of Acute Myocardial Infarction in the…

A: The passage is talking about the elderly patients who suffer from acute Myocardial Infarction which…

Q: Discuss the effects of a named toxin on the human body. Please include details of the mechanism of…

A: Animals and plants can produce compounds called toxins that are dangerous (toxic) to humans. Some…

Q: Part 1: Briefly describe the levels of organisation within the Human body. You should start your…

A: Organizational levels are natural structures that are typically described by part-to-whole…

Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…

A: A diagrammatic representation of biological entities related via common descent, like species or…

Question

100%

Pls asap

What does cortisol do in the acute response to stress?
O Prepares the body for fighting an infection.
O Dilates the pupil of the eye to improve vision.
O Increase motility in the intenstines
O Suppress the immune system

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The pituitary detects a rising hormone concentration in blood and inhibits the gland that is secreting the hormone. This is a ___________ feedback loop. a. positive b. negative
What is the function of the hormone erythropoietin? a. stimulates production of red blood cells b. stimulates muscle growth c. causes the fight-or-flight response d. causes testosterone production
Most of the hormones produced by the anterior pituitary perform what function?a. regulate growthb. regulate the sleep cyclec. regulate production of other hormonesd. regulate blood volume and blood pressure
Why would a hyperactive thyroid cause Kathy’s weight loss, elevated heart rate and sweating? In your response include the general action of thyroid hormones
Leptin and insulin have similar functions; both are hormones that: A) inhibit NPY release and activate POMC neurons in the arcuate nucleus. B) are secreted by fat cells in the body. C) increase hunger, eating behavior, and calorie intake in humans.
Your immune system has detected an invading bacterial infection. Cytokines are released. What do you predict will happen in terms of your thermoregulatory set point? Choix de groupe de réponses Your thyroid gland will release endorphins to decrease your metabolic rate, cooling you down Your thyroid gland will release melatonin to increase your metabolic rate, cooling you down Your hypothalamus will decrease the set point, making you feel warm relative to your previously normal body temperature Your hypothalamus will increase the set point making you feel chilled at your previously normal body temperature
Cortisol levels grow during times of stress. Oxytocin is a hormone that promotes relaxation and amorous sentiments. Cortisol and oxytocin are both proteins.
Elevated levels of cortisol have been shown to reduce areas of the hippocampus in the brain resulting in short term memory loss in older adults.(source: Sonia J. Lupien et al. Nature Neuroscience 1, 69–73 [1998])Exposure to long-term stress results in elevated levels of cortisol in adults. Over time, cortisol may have detrimental effects on your health.Determine the effect below that is NOT a result of long-term stress.
Without sufficient iodine the thyroid gland cannot synthesize thyroid hormone. This lack of sufficient thyroid hormone in the blood plasma causes the____. A pituitary gland to stop secreting thyroid stimulating hormone B pituitary gland to secrete more thyroid stimulating hormone than normal C metabolic rate and heart rate to increase D individual to feel too hot even when the room temperature is normal
Which of the following hormones is not an integral part of the stress response?a. ACTH d. Insulinb. Epinephrine e. Glucagonc. Cortisol
Thyroid hormones directly regulate which aspect of humanphysiology?a. circadian rhythm b. stress responsec. sex hormone productiond. metabolic ratee. None of these are correct
Thyroid hormones directly regulate what aspect of humanphysiology? a. circadian rhythmb. stress responsec. sex hormone productiond. metabolic ratee. None of these are correct