What is the best desccription for these tissues: Cartilage, Vascular (Blood) Tissues, Reticular Connective tissues, Mesenchyme. (2-3 sentences only) Description:
Q: https://www.youtube.com/watch?v=FVuNTiqHys0 Do you think that animals like Koko who has the…
A: The hypothesis proposes that all species of life forms emerge and create through the natural…
Q: 4.explain in deatails positive and negative the role of the american cocorach plays with humans 5)…
A: American cockroach is the largest species of domestic Cockroaches. They are not a confined to…
Q: what role does the brain play in hunger regulation and dysregulation
A: The brain manages our hunger. It has a "hunger center" and "fullness center" in the hypothalamus.…
Q: Which biome has the highest diversity of species? A) temperate rainforest B) temperate seasonal…
A: Tropical rainforests are lush, biodiverse ecosystems found near the equator. They have high…
Q: D G A C E B F H
A: In phylogeny, clades represent groups of organisms that share a common evolutionary ancestor. They…
Q: You are required to select your organisms from four different phyla. You cannot use the same phylum…
A: Phylum Mollusca:Organism: Giant Clam (Tridacna gigas)Taxonomic Structure: Kingdom: Animalia, Phylum:…
Q: AA AS SS otal viduals in these individuals in these individu
A: Population genetics includes the study of genotypic and allelic frequencies within a population.
Q: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
A: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
Q: Label the diagram: 3'4 5' Primer 5' 15' '3'
A: The heterocatalytic processes by which a new DNA strand is synthesized on a old DNA template is…
Q: This is an image of skeletal muscle tissue. Identify the structure labeled "A" (a) (b) myosin…
A: Muscles are exceedingly specialized soft tissues that play a pivotal part in creating movement and…
Q: Imagine that all six of the key players in the discovery of the structure of DNA had agreed to work…
A: James Watson, Francis Crick, Rosalind Franklin, Maurice Wilkins, Linus Pauling, and Erwin Chargaff…
Q: ich of the following answers are true about adenosine triphosphate (ATP)? Note, there may be MORE…
A: ATP stands for adenosine triphosphate. It is used as an energy currency in lot of metabolic…
Q: Which line represents the activation energy of the non-catalyzed reaction? Free energy L a. b. C. d.…
A: Answer : the graph which represents activation energy of non catalyst is : C) cexplaination : non…
Q: Which of the following is false? O alpha receptors cause smooth muscle to contract O Beta receptors…
A: G protein-coupled receptors such as muscarinic, beta, and alpha receptors are involved in…
Q: Part II. Basic Body Plans Cross Section of Planaria Cross Section of Roundworm
A: A cross section or T. S also known as an axial plane is obtained by dividing the body into head and…
Q: This graph shows the relationship between the number of individuals in a minnow school and how often…
A: The graph is about the minnow size and attacking predators. The graph shows the relationship between…
Q: A woman and a man have a red-green colorblind daughter. What can you say about the genotypes of the…
A: Color blindness, particularly red-green color blindness, is a sex-linked recessive genetic trait.
Q: OXWTMA OU G K Т М А Q GKWTMAQC ++ + - ++ - - - - - + - + - + - - + - + - + + + - + + A cistron is…
A: In a complementation chart a group will contain similar mutations that failed to complement one…
Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: bacterial replication fork
A: This is the site within a bacterial DNA molecule where the replication of DNA occurs actively.This…
Q: Cellular Genetics 1. The following sequence of bases is found on one strand of DNA. What is the…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is present within the…
Q: Which of the types of energy is NOT one a part of energy transformation chain during respiration and…
A: Several cellular organisms with chlorophyll employ the biological procedure of photosynthesis and…
Q: Why is biodiversity important to the health of an ecosystem?
A: Biodiversity refers to the variety of life on Earth, encompassing different species, ecosystems, and…
Q: the A and the S alleles are co-dominant. What is the phenotype of a heterozygote (AS)?
A: Codominance is a genetic concept where two different alleles of a gene are equally expressed in a…
Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pl, bk,…
A: The scenario presented involves an exploration of genetics using Drosophila or fruit flies. In this…
Q: Which of the following statements about the evolution of life on Earth, from simple prokaryote-like…
A: The evolution of life on Earth is a remarkable process that has led to the development of complex…
Q: I have a large number for my standard deviation. What does this tell me about the variability in my…
A: Standard deviation is the deviation of the given set of data from it's mean value. In statistical…
Q: In Drosophila,, the curled mutation (cu, chromosome 3, position 50.0) results in wings that curl up,…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Question 29 A gene that codes for a receptor for a growth factor is mutated. A normally…
A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of mistakes in…
Q: two chromosomes with the same alleles in the same sequence two chromosomes with identical alleles…
A: According to the guidelines of Bartleby,“Since you have posted multiple questions, we will provide…
Q: Question 38 If human gametes were diploid the products of fertilization would have more…
A: DNA is the genetic material of living organism. DNA is a double stranded macromolecule that contains…
Q: A) carbon-hydrogen bonds B) NAD+ C) CO2 OD) NADH OE) ATP
A: According to the guidelines of Bartleby,Since multiple questions are posted, the expert can only…
Q: can you explain the mechanisms that control the activity of enzymes?
A: Enzymes are biological enzymes that catalyze (enhance) chemical processes in living organisms.…
Q: *Cystic fibrosis is a rare autosomal recessive condition. A phenotypically normal man whose father…
A: Mendel proposed three laws based on his research. His research provided a picture of the independent…
Q: Why is cytosolic K+ highly concentrated when the extracellular K+ concentration is low even though…
A: The concentration of potassium ions (K+) inside a cell's cytosol is a finely regulated phenomenon…
Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…
A: In the context of nutrition and dietary science, it is essential to understand the energy content of…
Q: nzyme. So you want to assemble a gene and put it in the ants. Below is a schematic of the ant gene,…
A: Few important terms .Plasmid :A plasmid is a small, circular piece of DNA that differs from a…
Q: Tackle the question of how we determine membership in a particular species?
A: Definition A species is a group of organisms having similar features. A particular species has…
Q: Following is a list of constitutents found in eukaryotic cells. Rank each constituent in order, from…
A: Large and sophisticated creatures are made up of eukaryotic cells, which have a nucleus surrounded…
Q: Which codons do not have a matching tRNA? Select all that apply O UAA O AUG OUGA UGG OUAG
A: Transfer RNA (tRNA) is defined as a subclass of RNA molecules which is essential for the translation…
Q: What neurotransmitters are involved in memory retrieval and how does their pathways work?
A: Memory retrieval involves the activation of specific neural pathways and the release of…
Q: Polyethylene glycol (PEG)-conjugated IFNs have superior pharmaceutical properties compared with…
A: Polyethylene glycol (PEG)PEG, short for polyethylene glycol, is a type of substance that is good at…
Q: The graph below shows the growth rate of a bacterium (cell divisions/hr) as a function of time.…
A: Growth rate of bacteria is the rate or speed at which the number of organisms in a population…
Q: Scientific name (Genus species) - This must be formatted correctly. If your group includes more than…
A: Primates are a diverse order of mammals characterized by features such as forward-facing eyes,…
Q: Match the hypersensitivity to the example, each type can be used more than once or not at all. ✓ Hay…
A: Hypersensitivity is the reaction of the immune system to certain substances resulting in allergic…
Q: Punctate, errose, lobate, dry, convex, swarming, yellow, and circular are all terms that describe:…
A: Anabolism is a part of metabolism in which simple substances are formed from complex substances.…
Q: How many chromosomes are shown in this picture? O 1 1234 O 5 ↑
A: A chromosome is a long, thread-like structure found in the nucleus of a cell. It carries genetic…
Q: make a concept map out from the essay below. The epic story of a single sperm facing incredible…
A: Fertilization is a multi-step, complex process that takes 24 hours to complete. The beginning of…
Q: Imagine you are a college student volunteering for a nonprofit cancer organization that houses…
A: Cancer is a condition characterized by uncontrolled cell growth and division in the body. These…
Q: If a recombination frequency cannot be above 50%, what does it mean if two genes are, say, 60 mu…
A: Recombination is a process by which two molecules of DNA exchange pieces of their genetic material…
What is the best desccription for these tissues: Cartilage, Vascular (Blood) Tissues, Reticular Connective tissues, Mesenchyme. (2-3 sentences only)
Description:
Step by step
Solved in 3 steps
- Identify and describe the tissues shown below.what kind of tissues are pointed in the following? explain.Under HPO, label the following parts of the diagram of a sectioned fallopian tube showing the Simple columnar epithelium : non-ciliated secretory cell, ciliated columnar cell, cilia, nucleus, cell membrane, cytoplasm, lumen and basal lamina.
- What happens to the tissue if it is not immediately fixed?What type of tissue is labeled B____________________________________?Epithelial tissue is an important part of the body as a covering of surfaces and as a lining of the internal hollow organs. Discuss how histologists can use visualization of epithelial tissue to help with diagnosis of diseases in different parts of the body. cite sources and include in-text citations
- identify the tissuesMatch the tissue shown with its function. options: 1. Present in bone marrow, spleen, and lymph nodes.2. Allows us to think.3. Triceps brachii are needed for arm extension.4. Provides a smooth surface.5. Support and binding of other tissues.6. Stores energy in the form of fat.7. Propulsion of food and liquid through gastrointestinal tract.8. Allows the ribcage to be flexible;necessary for breathing to occur.9. Protective,withstands abrasion.10. Secretion (mucus, HCI, etc.), protection, absorption.11. Propels blood through the heart12. Part of skeletal system: support, movement, production of blood cells.13. The only liquid connective tissue. It transports substances and cells.14. Lines tubules in kidneys.15. Allows for elastic recoil of large arteries like the aorta and of alveoli during exhalation.16. Thin for rapid diffusion of gases17. Creates the mucociliary escalator that protects the respiratory system from microbes and debris.Identify the structure being described in each number. __________ 1. Tissue with cells that is taller than wide found in the trachea and bronchi. __________ 2. Gland with duct that brings the secretion from the secreting cells to the specific target organ. __________ 3. The non-living substance present in bone. __________ 4. Tissue that consist largely of fat cells. __________ 5. The cell cartilage.
- How can you relate the Concept of Tissue Integrity to future professional clinical practice, explain in ~ 150 words.?Which type of tissue, as categorized in class, is most easily seen (blocks x-rays) bestplese help me to fill in the following table Tissue Description(Cell Shape and Layering) Location of Tissue Function of Tissue Simple squamous Simple cuboidal Simple columnar Pseudostratified columnar Stratified squamous
