Q: Question 1 Identify a FALSE statement from the following, O peptidoglycan in Gram negative wall is…
A: Question (1) Answer :-Correct option is (e) lipid A induces activated macrophage yo secret…
Q: what is the name of this structure and what fun function and pathway does if take?
A: Introduction The reactions which help in converting pyruvic acid to carbon dioxide and water in…
Q: What are the checkpoints in the completion of the life cycle of nematomorphs? Would it be easier if…
A: The phylum Nematomorpha (also called horsehair worms) is constituted of orders: Nectonematoidea…
Q: All of the following describe a gamete, EXCEPT: a) sperm b) haploid c) zygote d) egg
A: Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes…
Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False
A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…
Q: Why is it important to wash fruit
A: Washing is a basic hygiene and safety process for the consupmtion of fruits and vegetables. It is…
Q: The number of Microorganism A was exposed to a constant temperature of 117 C surviving spores of the…
A: D value is decimal reduction time and is described as time needed at a particular temperature for…
Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?
A:
Q: Select all that apply about 02 and CO2. O Both are nonpolar molecules. Both can diffuse passively…
A: 1) Both O2 and CO2 are the non polar , uncharged molecules which passes through the membrane by…
Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…
A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…
Q: Which vertebra has odontoid process? a) Atlas b) Axis c) Cervical d) Coccyx
A: Introduction The interconnecting bones that make up the spinal column are known as vertebrae. The…
Q: Briefly summarize the conventional wisdom (DNA mutation theory) of the cause of cancer. Discuss the…
A: It proposes that successive DNA mutations in a single cell cause cancer (monoclonality). This…
Q: Please select a disease (like cancer) that can be modeled through the generation of induced…
A: Pluripotent stem cells have been used in the treatment of diseases and various other programs like…
Q: When considering genetic health, who should decide which genes are harmful or beneficial?
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: Question 2: Is it just a regular cold or COVID-19? Compare and contrast the two infections. In your…
A: Within the twentieth century, the globe suffered pandemics. The pandemics, as horrifying and lethal…
Q: What are 7 herbivores organisms
A: Herbivores, are those animals that are anatomically and physiologically adapted to eating plant…
Q: A cell that proceeded to cell division without completing S phase would: O have extra ribosomes have…
A: Answer :- (D) not have enough DNA to divide normally
Q: A transition mutation would be replacing A by
A: Transition mutation is a process in molecular biology and genetics where it refers to point in…
Q: Why does a muscle cell express a different set of genies compared to a white blood cell? Why do…
A: The muscle cells and the white blood cells comprise different sets of genies depending on different…
Q: Q2/ What is meaning the Nitrification and De-nitrification processes ?
A: Nitrification is a microbial process that which reduced nitrogen compounds (primarily ammonia) are…
Q: Blood is stained with stain. a) Methylene blue b) Safranin c) Leishman stain d) Carbol fuchsine
A: Introduction - A blood smear, also known as a peripheral blood smear or blood film, is a thin…
Q: What are the parts of auricularis muscles and their specific functions? Tabulate the origin,…
A: The craniofacial muscles are a set of roughly 20 flat skeletal muscles that lie beneath the skin of…
Q: A person of type A blood receives blood after a collision between a car and a bus. Shortly after,…
A: Blood transfusion is a process of transferring the same type of blood from the donor to the…
Q: 7.Who is known as the "Father of Genetics"? A. Morgan B. Mendel C. Watson D. Bateson 8. The term…
A: Genes are comprised of DNA. A genes go about as guidelines to make molecules called proteins.…
Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…
Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…
A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…
Q: Describe the variety of growth forms in sac fungi
A: Introduction Fungi are eukaryotic organisms. They can reproduce sexually as well as asexually by…
Q: The elements that present in Protoplasm
A: A cell's protoplasm, cytoplasm, and nucleus are all examples of protoplasm. The phrase was first…
Q: Alter death, calcium pumps no longer fünction and the calcium ion concentration of muscle fiber…
A: * After death of an animal or organism the calcium pump stops hence calcium should not be pumped and…
Q: Is cell division happening during the entire cell cycle? What is interphase?
A: Introduction - A cell cycle is a sequence of events that occur in a cell as it divides and expands.…
Q: Justify the variable term 'desirable trait' with suitable examples.
A: For different plants, the desirable trait may be expressed in a different way. The following…
Q: Alleles are
A: A gene is the basic physical and functional unit of heredity.
Q: Pruning results in a greater photosynthetic area and therefore lesser foods are manufactured? True…
A: Introduction Pruning is when you selectively remove branches from a tree, It allows room for new…
Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…
A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…
Q: Examples of viral Pathogen Associated Molecule Patterns (PAMPS) that tigger cell defenses are which…
A: Here we discuss about pathogen associated molecular patterns.
Q: Can you determine the source of contamination (for example, human, domestic animal, or wild animal)…
A: Contaminants and contamination Contamination means the alteration in the original properties. Water…
Q: Ma nave 1. requires ATP A. diff 2. random movement of molecules from high to low B. fa 3. molecules…
A: Cell transport is a mechanism that brings about the movement of materials across the cell membrane.…
Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…
A: Brain senses the changes in the blood glucose levels but the information is processed by the PNS and…
Q: E Which choice best describes the location of the majority of the musculo-skeletal system? A. It is…
A: Introduction Bones, muscles, tendons, ligaments, and soft tissues make up the musculoskeletal…
Q: 1. What name is given to the process of endospore formation in a bacterial cell? 2. How long is…
A: Introduction 1. Endospore formation is usually triggered by a condition of starvation or lack of…
Q: First find and label ATP Synthase on the diagram below. Make boxes and add the labels for ATP, ADP,…
A: Cellular respiration takes place in four steps glycolysis where glucose is converted into pyruvate.…
Q: e the presence of saliva
A: Saliva is a thick, colourless, opalescent fluid that is constantly present in the mouth of humans…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: 22. Single base substitution is A. Point mutation B. Deletion C. Substitution D.…
A: Mutations These are defined as the alterations in the sequence of the DNA due to exposure of…
Q: What are the germ layers? How many germ layers do sea sponges have? What phylum do sea sponges…
A: Germ layers are formed in the early embryonic stages of foetal development, they ultimately form…
Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…
A: We are given the amount of each component present in liter of the culture. 3 g of Polypeptone is in…
Q: 24. Chromosomes are also known to contain protein A. True B. False
A: Each cell in our body contains chromosomes. In the human body, there are 23 pairs of chromosomes in…
Q: The joint between atlas and axis is 1) Ball and socket joint p) Saddle joint ) Pivot joint 1)…
A: All given options are different types of synovial joints. A synovial joint is formed by the ends of…
Q: Leptin was first discovered in a strain of mice (called ob mice). These mice have a genetic mutation…
A: * gene produces a hormone namely leptin which will be produced in adipose tissue which regulates…
Which came first, the chicken or the egg? give the funniest yet logical answer.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images