Which of the comparisons between DNA polymerase and RNA polymerase is false? -Both DNA polymerase and RNA polymerase have proofreading activity. -DNA polymerase requires an additional enzyme to unwind double-stranded DNA molecules, but RNA polymerase does not. -Both DNA and RNA polymerase catalyze the addition of nucleotides to the 3’ end. -DNA polymerase needs a free 3’-OH to begin the polymerization reaction, but RNA polymerase does not.

Which of the comparisons between DNA polymerase and RNA polymerase is false? -Both DNA polymerase and RNA polymerase have proofreading activity. -DNA polymerase requires an additional enzyme to unwind double-stranded DNA molecules, but RNA polymerase does not. -Both DNA and RNA polymerase catalyze the addition of nucleotides to the 3’ end. -DNA polymerase needs a free 3’-OH to begin the polymerization reaction, but RNA polymerase does not.

Name: Which of the comparisons between DNA polymerase and RNA polymerase is
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the comparisons between DNA polymerase and RNA polymerase is false?-Both DNA polymerase and RNA polymerase have proofreading activity.-DNA polymerase requires an additional enzyme to unwind double-stranded DNA molecules, but RNA polymerase d

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Draw the reaction between a growing strand of RNA and the next nucleotide added. Clearly show the interaction between the template DNA and the rNTP and draw arrows to indicate the reaction that occurs. How does this compare to what occurs in DNA polymerization?
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
The DNA polymerase cannot start making a new DNA polymer out of nothing, it needs preexisting nucleic acid to hook the new DNA onto. What is this preexisting nucleic acid called, what enzyme makes it, and what nucleic acid is the preexisting nucleic acid made of?
Sliding-clamp proteins load polymerase onto the primer and maintain its stable association with the template. true or false? DNA polymerases add a deoxyribonucleotide triphosphate to the 3' hydroxyl group of a growing DNA chain (the primer strand). true or false?
Which statement about Okazaki fragments is true? Select one: a. DNA polymerase doesn’t need a primer to build these fragments b. They act as a primer that initiates DNA replication. c. They correct errors made during earlier phases of DNA replication. d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork. e. They prevent the ends of chromosomes from shortening with every replication.
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
What is the major role of DNA polymerase in the DNA replication? a. Attached RNA primers to initiate the addition of complementary nucleotide sequence at the 5’ to 3’direction b. Adds up new complementary nucleotide sequence at the 3’ to 5’ direction of the DNA template. c. Unwinds the double helix by breaking the bonds at the 3’ to 5’ polymerization activity. d.It transiently cuts each strand to prevent supercoil at the 5’ to 3’ polymerization activity complementary to the RNA strand
Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of the top and bottom strands.
Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G
A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5’ and 3’ ends of the newly made strand.
Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.