:35Which of the following blood-related activities is not controlled by the endocrine system?Multiple Choicehelping regulate blood volumehelping regulate contraction of the heartproducing hormones that assist in blood cell formation VE V30Multiple Choicehelping regulate blood volumehelping regulate contraction of the heartproducing hormones that assist in blood cell formationSavedproducing epinephrine, which increases blood pressureHelp

Ans - Third answer of first image. Endocrine system do not produce hormones that asist in blood cell…

Answered: Which of the following blood-related…

Science

Biology

Which of the following blood-related activities is not controlled by the endocrine system? Multiple Choice

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter15: The Endocrine System

Section: Chapter Questions

Problem 5SQ: Which of the following stimulate the secretion of hormones? a. neural signals b. local chemical...

See similar textbooks

Related questions

Q: Contain the protein hemoglobin Function in immunity and fighting infections Transport oxygen and…

A: RED BLOOD CELLS- Hemoglobin is a protein found in red blood cells, sometimes referred to as…

Q: When you use the centrifuge the second time with the alcohol, where does the DNA go?

A: The type of nucleic acid known as DNA (Deoxy Ribo Nucleic Acid) controls the growth, metabolism, and…

Q: If a patient takes 1 tsp TID, how many milliliters will be needed for a 7-day course of therapy?

A: Teaspoon is smaller than tablespoon. 1 tablespoon holds 15ml while 1 teaspoon holds nearly 5 ml.

Q: Which is not a common symptom of diabetes

A: The pancreas is a mixed gland. It consists of endocrine and exocrine parts. The endocrine part…

Q: Draw the Prophase I pairing conformation that would result from this translocation. The four types…

Q: During which phases do the homologous chromosomes synapse (pair up)?

A: Introduction :- The pairing of two chromosomes that happens during meiosis is known as synapsis. It…

Q: ATP Cell wall Fermentation Gram - Nucleus Prokaryote Bacteria Chloroplast Flagella Metabolism…

A: There are two types of cells, eukaryotes, and prokaryotes. Prokaryotes are primitive unicellular…

Q: The role of NAD+ in cellular respiration is to move high-energy neutrons during the breakdown of…

A: Oxygen is required for cellular respiration and the metabolism of dietary energy (oxidative…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

A: There are various means of transport that are used to carry out transportation in plant and animal…

Q: In the following diagram, indicate the color of the xylem, phloem, cortex, epidermis and endodermis,…

A: Plants are multicellular , eukaryotic, photosynthetic structure that belongs to kingdom Plantae.…

Q: Write short note on Tanh and ReLU neurons.

A: Neurons are the fundamental units of the brain and the nervous system, the cells responsible for…

Q: In a cell membrane, which of the following will be able to freely move from one side of the bilayer…

Q: give a detailed overview of how tryglycerides are metabolized under aerobic conditions. note the…

A: Triglycerides are made up of 3 fatty acids and glycerol. Life pages enzyme breaks the bond and…

Q: You Answered 1. If a negatively supercoiled (ALK = -32) closed circular DNA is relaxed by one…

A: Linking number (Lk)= total number of base/basepair per helical turn in its relaxed form…

Q: Neurotransmitters are released from neurons due to the opening of ____________. Select one: a.…

A: Neuron is the sub unit of nervous system. It helps in coordinating the different body parts via…

Q: Design a pair of primers to amplify the entire length of the following 45 base pair sequence. Make…

Q: Make your molecular phylogony of the 6 mushroom species with given character matrix.

A: Molecular phylogeny It is the branch of phylogeny that examines genetic, hereditary molecular…

Q: Question 6,7,8(They are all related) *PHENOTYPES* Shv=small wrinkled wing Shv+=wild wing…

A: Progeny class Genotype Phenotype Proportion (Expected) Observed 1 shv+/shv; he/he Normal wing;…

Q: 1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino…

A: Ribosomes: All cells contain ribosomes, which are macromolecular machines that carry out biological…

Q: 3d bioprinting systems, biomaterials, tissue engineering. Find a creative project topic on the…

A: Tissue engineering is a highly sophisticated and modern technique that is utilized in today's world…

Q: Which characteristic of life is described by the following? Inflammatory response due to a wound…

A: The word "living" refers to "alive", living things has many cahrctertucs such as they respond to…

Q: Which of the following is true of irrigation? O A. Irrigation refers to the use of water for growing…

A: Water is a precious element on earth and it makes the hydrosphere of earth. This inorganic molecule…

Q: Match the following conditions with the expected state of primary human cells grown in culture for…

A: The process through which cells are cultivated under controlled circumstances, typically outside of…

Q: ording to the water potential values shown in the image, which ones are wrong and why? W air (22 °C,…

A: Water potential is the energy required, to transport small quantity of water from the sample to a…

Q: Compare the amount (haploid or diploid) and arrangment of material (number of chromatids per…

A: There are two types of cell division mitosis and meiosis. Mitosis is a single division that occurs…

Q: Small intestine 1. How long is it ? Which segments make up the small intestine? Which foods are…

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…

Q: Explain what are the advantages and disadavatges of the CIN, MSI, CIMP pathways and the inflammatory…

A: The Mendelian gene is a basic unit of heredity and the molecular gene is a sequence of nucleotides…

Q: Consider the following reaction: glyceraldehyde-3-phosphate + NAD  1,3bisphosphoglycerate +…

A: An electron transport chain (ETC) is a collection of protein complexes and other molecules that…

Q: Which condition is least likely to promote mutualistic relationships between plants and fungi?…

A: The mutualistic relationship between plants and fungi is known as mycorrhiza. The fungi is benefited…

Q: Match the disease with the pattern of inheritance Phenylketonuria Achondroplasia Red-green…

A: A genetic disorder is a disease caused in whole or in part if there is a change in normal DNA…

Q: Why might viable cell cultures be of more use in microbial taxonomy than preserved specimens?

A: Microbial taxonomy means classification and nomenclature and identification of microbes (algae or…

Q: photosynthesis and respiration

A: Photosynthesis: It is defined as the process by which plants use sunlight, water, and carbon…

Q: The diagrams represent four possible phylogenetic relationship between the four species: M, L, S,…

A: The phylogenetic tree represents the evolutionary relationship between taxons in the phylogeny. It…

Q: can serology be used to confirm agglutination?

A: Blood is the main medium of transport in human bodies. It carries oxygen to all parts of the body…

Q: What is not controlled using the Shared or Equal Environments Assumption? Genetics Controlled…

A: Introduction:- Genetics is the branch of biology that deals with the inheritance , inheritance…

Q: The source of electrons that fuel the chloroplastic electron transport chain is

A: Photosynthesis is the process by which green plants and some other organisms use sunlight to…

Q: turtles, lizards, snakes crocodiles dinosaurs parental care keratinized skin amniote egg bipedalism…

A: Phylogenetic tree is a graphic representation of the course of evolution.It provides a way to…

Q: Table K₁ (T1) Vmax (T1) Kt (T2) Vmax (T2) 1.12 mM 125 nmole/min 3.0 mM 130 nmole/min Based on these…

A: Enzyme kinetics studies the effect of the substrate concentration and other factors on the rate of…

Q: Which of the following organisms cannot perform oxidative phosphorylation? Select one: a. E. coli b.…

A: Oxidative phosphorylation refers to the production of ATP by ADP driven by energy released from the…

Q: How will the function of skeletal muscle tissue in your hands be affected over time when used…

A: Muscles are the body's greatest protein storage facility. Whenever dietary protein is scarce, the…

Q: 1. Can a test determine an individual's biological sex? And can testosterone produced by an…

A: Biological sex is of two types - male and female. There is a definite sexual dimorphism occurring in…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Could the statement below be correct? Why or why not? Armillaria ostoyae, the honey fungus, is the…

A: Armillaria ostoyae is a fungus species belongs to physalacriaceae which is pathogenic to trees.…

Q: Provide one probable consequence if mitosis had never evolved

A: Cell division is the process by which cells divide to produce daughter cells. It is an important…

Q: ese and S. . ing Which approach would most successfully increase the populations of kit foxes in…

A: Habitat refers to an area that supports the survival of organisms through the availability of…

Q: Ozana was born with cataracts, which made her completely blind. When she was 14 years-old she…

A: Neuroplasticity, also known as brain plasticity, is the ability of the brain's biological, chemical,…

Q: One enzyme can catalyze many different reactions as long as the specific substrates for those…

A: Enzymes are proteinaceous substances that when involved in a chemical reaction, speed up the rate of…

Q: Not all of the DNA in an organism contains genes. Explain and relate in marker development to tag a…

A: Gene is a region of DNA which codes for a functional product which could be a mRNA or a specific…

Q: Which of the following components are required for the polymerase chain reaction (PCR)? Select all…

A: The components that are required for PCR are- dNTPs, DNA polymerase, Oligonucleotide primers

Q: Which characteristic of life is described by the following? Budding in hydra Organelles make up the…

A: Life is the characteristic of all living organisms that have all or some of the folowig…

Question

:35
Which of the following blood-related activities is not controlled by the endocrine system?
Multiple Choice
helping regulate blood volume
helping regulate contraction of the heart
producing hormones that assist in blood cell formation

VE V
30
Multiple Choice
helping regulate blood volume
helping regulate contraction of the heart
producing hormones that assist in blood cell formation
Saved
producing epinephrine, which increases blood pressure
Help

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Answer

VIEW

Step 2 Endocrine system

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Match the endocrine control concepts.
Which of the following stimulate the secretion of hormones? a. neural signals b. local chemical changes c. hormonal signals stimulate hormone secretion d. environmental cues e. all of the above can
Give a general description of the endocrine system and explain briefly its primary responsibilities within the body.
Identify the major organs and tissues of the endocrine system and their location in the body
Give examples of endocrine disorders.
List and describe the three types of stimuli that trigger endocrine glands to synthesize and to release hormones. (max 9 sentences)
Discuss the size and location of the major endocrine organs. State a common household item that is similar to the size or shape of each organ
gr… Show more Match the following actions with the appropriate hormone Potential Matches: 1 : growth hormone 2 : thymosin 3 : antidiuretic hormone 4 : parathyroid hormone 5 : prolactin 6 : insulin Answer : stimulates milk production : promotes water retention : stimulates growth of bone and muscles : reduces blood glucose levels : raises blood calcium levels : programs T lymphocytes • Show less
Regarding the endocrine system, which of the following statements is FALSE? A. Hormone secreted during times of high motion tend to interfere with memory formation B. The emotional issues of adolescents are due in part to elevated levels of hormones C. A chemical level, hormones are similar to neurotransmitters D. Androgens (“male hormones”) are related to the sex drive in both males and females.
Summarize the major effects of increased plasma concentration of cortisol during stress?
Elevated levels of cortisol have been shown to reduce areas of the hippocampus in the brain resulting in short term memory loss in older adults.(source: Sonia J. Lupien et al. Nature Neuroscience 1, 69–73 [1998])Exposure to long-term stress results in elevated levels of cortisol in adults. Over time, cortisol may have detrimental effects on your health.Determine the effect below that is NOT a result of long-term stress.
Define stress, and list the functions of cortisol during stress?