Which of the following is NOT a component of the human body's second line of defense against pathogens? A) Platelets B) Blood clotting C) Vasodilation D) Antibodies E) Ferritin proteins F) Production of fibrin polymers
Q: The hypothalamus primarily controls: a. olfactory reception and audio-visual processing Ob.…
A: ANSWER 51) In order to answer this question we need to understand what is hypothalamus. Hypothalamus…
Q: In superheroes, the gene for superstrength has two alleles. The dominant allele (S) codes for normal…
A: When an individual has two distinct allelomorphic forms (genes), only one of them, the dominant gene…
Q: A chloroplastic protein is encoded by a gene in the nucleus. Which of the following orders correctly…
A: Proteins are biomolecules made up of monomer units "amino acids" adjoined by "peptide linkages".…
Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…
A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…
Q: Which of the following is the most important trait in terms of evolutionary success a. production of…
A: Natural selection, the theory behind Charles Darwin's theory of evolution, holds that organisms with…
Q: Repolarization is when the cell membrane potential becomes more positive the sodium channels open on…
A: Introduction : An action potential is a short period of time during which a cell's electrical…
Q: What structure does the proximal tubule lead to? O O intermediate tubule O glomerulus O distal…
A: In vertebrates,Kidneys are the main oragn which involved in excretion.In each kidney,there is…
Q: Ch. 7: All of the following may lead to chronic kidney disease EXCEPT: a) renal artery stenosis b)…
A: To prevent a stone recurrence, guidelines advise increasing water consumption to produce a urine…
Q: 29. Correctly label each image below with the ELISA method it is describing (3pts) Ag Ampan…
A: Introduction:- ELISA is a plate based assay technique designed for detecting and quantifying soluble…
Q: Fast block to polyspermy is achieved by a. exocytosis Ob. actin polymerization Oc. action potential…
A: Polyspermy is the fertilisation of an egg with more than one sperm. “Poly” means many and “spermy”…
Q: Ch. 6: Signs and symptoms of hyponatremia would include: a) headache, rapid breathing, high…
A: ANSWER) Hyponatremia is described as the state of low sodium levels in the body which are mainly due…
Q: DNA has the O thymine; uracil nucleotide, whereas RNA has the thymine; adenine O adenine; cytosine O…
A: INTRODUCTION DNA : Deoxyribonuleic acid RNA : Ribonucleic acid
Q: energy used during the chemiosmotic synthesis of ATP in both mitochondria and chloroplasts es…
A: Chemiosmotic model was explained by Peter Mitchell. This is applied not only to mitochondrial…
Q: Slow block to polyspermy is linked to the cytosolic accumulation of the ion Select one: sodium O b.…
A: A polyspermy egg is one that has been fertilised by several sperm. Every chromosome in a diploid…
Q: We now have at least three SARS-CoV-2/COVID-19 vaccines approved by the FDA for use in the United…
A: The vaccines are: 1. Pfizer-BioNTech – Authorized on December 11, 2020 2. Moderna – Authorized on…
Q: O Do concussions cause memory loss?
A: A brain injury is caused by an external force, but it also includes any subsequent repercussions,…
Q: Explain why each of the following questions are best answered by an observational study or an…
A: The collection, analysis, and interpretation of data are crucial parts of statistics. The data can…
Q: The overall goal of chemiosmosis is to make ________ in the __________. Select one: a. NADH, Kreb’s…
A: Chemiosmosis takes place in the mitochondria during respiration and in the chloroplasts during…
Q: why are the color and consistency of cooked meat different than that of raw meat? a.) the…
A: The term "meat" refers to the flesh portions of animals used for nourishment. Such portions comprise…
Q: Ch. 6: Hypophosphatemia would most likely result in a patient: a) having a prolonged QT interval in…
A: Phosphate is one of the most important molecular elements to normal cellular functions within the…
Q: Ch. 8: Which of the following is UNLIKELY to improve the symptoms of premenstrual syndrome? a)…
A: Premenstrual syndrome (PMS) is a collection of physical and emotional symptoms that occur in the…
Q: Describe the structure of a phospholipid and a phospholipid bilayer
A: Phospholipids are present in cell membranes. They are amphipathic in nature.
Q: The vast majority of human cancers mutations in the p53 gene. What is the function of p53 normally…
A: Cancer can be defined as a condition ,in which cell losses its usual control over their division ,…
Q: Suppose a lysosomal protein escapes into the cytosol; it will then become ___ of the cytosol Select…
A: Introduction: Proteins, nucleic acids, carbohydrates, and lipids can all be subdivided by a wide…
Q: Peptic ulcers are now thought to be mainly caused by Campylobacter Escherichia coli Helicobacter…
A: The upper portion of the small intestine and the interior lining of the stomach can develop open…
Q: A. The aldaric acid of D-idose is the same as the aldaric acid of which sugar? B. The aldaric acid…
A: Food serves as a source of energy for humans. It is made up of main components such as carbs,…
Q: Some drugs may reduce DNA methylation at the promoter of the reelin gene. What is the likely impact…
A: Introduction: A protein called reelin is produced using instructions from the RELN gene. Both…
Q: True or False: A germinal mutation will affect the individual in which it occurs but will not affect…
A: Introduction:- Mutations are defined as the heritable changes in the genetic material of an…
Q: Explain how the natural history of disease pathogenesis may guide implementation of health promotion…
A: Introduction The Natural History of a disease signifies the way in which a disease evolves over time…
Q: Explain the principle and procedure of an IndirectELISA
A: Enzyme-linked immunosorbent assay, or ELISA, is a method for identifying the presence of antigens in…
Q: Ch. 5: All of the following can arise from lower respiratory tract infections EXCEPT: a)…
A: The correct answer is option c. Epiglottitis. All of the given conditions can arise from lower…
Q: The cnidaria, jelly fish, are the first organisms to exhibit? a) an ectoderm layer b) endoderm layer…
A: The earliest animals with muscles and nerves that could produce behavior were cnidarians.…
Q: Of the items listed, which is NOT a necessary life function? carbon dioxide maintaining boundaries…
A: Introduction Organisms need or must maintain a set of necessary life functions in order for them to…
Q: evaluate the relationship between the role of biological fluids and their function in the context of…
A: All bodily liquids that assist in the movement of nutrients or the removal of waste from cells…
Q: 50 40 30 20 10 0 [°C] Jan Feb Mar - Apr May Jun Jul Aug Sep Oct Nov [mm] 100 - 80 - 60 -40 - 20 0…
A: Between the tropics and the poles are the temperate biomes. The transitions between summer and…
Q: Ch. 8: A fluid-filled cyst that occurs in the layers of the tunica vaginalis surrounding the testes…
A: Between the parietal and visceral layers of the tunica vaginalis, which immediately encircles the…
Q: Some eastem North American populations of apple maggot (Rhagoletis pomonella) have shifted hosts…
A: The process of formation of new species is referred as speciation. Speciation occurs with the help…
Q: certain cells in the pancreas of animals produce and secrete insulin. Which of the following…
A: Insulin is a peptide hormone which is made in the beta cells of Islets of Langerhans of pancreas. It…
Q: Glycogen stored in muscle and liver is used for following organs in the order: Select one: a.blood,…
A: Note: please always mention the needed parts in case of multiple questions. Thank you! Enzymes are…
Q: distal collecting tubules
A: Reptile kidneys are relatively simple in structure compared with birds and mammals. They contain…
Q: 1. Complete the table Genome type Capsid Envelope Transmission Viral replication occurs in The virus…
A: Virus An incredibly small infectious agent that can only exist within a cell, and a tiny bundle of…
Q: describe the mechanism in which roots can express positive geo-tropism
A: The root cap is said to experience the effects of gravity. In the event that the plant's roots had…
Q: Ch. 8: Failure of the testes to descend from the abdomen to the scrotum during development in utero…
A: • Priapism : It's a prelonged erection of the external genitalia in male without sexual arousal male…
Q: In humans, selenocysteine is _______. Select one: a. a toxic amino acid encoded by the cysteine…
A: The 21st amino acid, selenocysteine, is distinctive among the amino acids that are proteinogenic. It…
Q: he human phenotype is regulated by epigenetic control of gene expression. Discuss the three main…
A: It is suggested that epigenetic mechanisms play a significant role in how the genome reacts to its…
Q: Which one is wrong for carbohydrate absorption from intestine? A) Glucose can be absorbed into the…
A: Active transport occurs across the microvillus membrane of the small intestine to absorb…
Q: MATCH THE FOLLOWING by putting a checkmark. TOPIC: TYPE OF INTERACTIONS. HIGH SCHOOL BIOLOGY Clumped…
A: Organisms live and thrive in the environment while interacting with both biotic and abiotic…
Q: Cohesin proteins function as ______, and are most likely degraded during the early steps of…
A: Cohesin is a multisubunit protein complex. They are necessary for the cohesion between sister…
Q: Which of the following statements about vaccines is NOT correct? Smallpox vaccinations are no longer…
A: The term vaccine is associated with a substance that is given to a person to boost their immune…
Q: 4.3. Calculate the carbon dioxide volume expired during one hour by person performing the physical…
A: ANSWER) Volume of air expired in one expiration is 500mL. Number of breaths in one minute in normal…
Which of the following is NOT a component of the human body's second line of defense against pathogens?
A) Platelets
B) Blood clotting
C) Vasodilation
D) Antibodies
E) Ferritin proteins
F) Production of fibrin
Step by step
Solved in 2 steps
- What is an antigen?Bryan is a physician at a major metropolitan hospital. Since the attacks of September 11, 2001, his hospital has been preparing for a terrorist attack. Why does the CDC recommend using antibiotics only when exposure to disease is suspected or confirmed?What is the difference between an antibody and an antibiotic?
- What do you mean by fixed macrophages?Why does the immensely powerful immune system of the body, an organ system that has evolved over millennia of challenges from a wide variety of infectious and noninfectious invaders to become an exceedingly effective defender of the body against agents far more virulent than HIV, now appear to be powerless against it?What is immune?