Which of the following relax twisting stress in DNA molecules? (Select all that apply.) Topoisomerase activity Positive supercoiling Methylation of uridines Nucleosome winding None of the above. Submit Answer Try Another Version 1 item attempt remaining
Q: Genetics Problem show the table and word In certain breeds of chickens, the allele "B" is…
A: A classic example of this complexity can be found in certain breeds of chickens, where two sets of…
Q: Describe the structure of the influenza virion. Explain how the form of the influenza genome enables…
A: The structure of the influenza virus particle, also known as the virion, is what enables it to…
Q: In the simple picture below we are focusing on the chromosomes. Notice that the chromosomes are…
A: Chromosomes are thread-like structures which are visible during cell division. Cell division is a…
Q: Question1: Describe the functions of at least 4 different cytoplasmic organelles? Also, explain the…
A: Organelles, also known as cytoplasmic organelles, are specialized structures that are present in…
Q: Discuss the processes involved in the digestion of food in vertebrates
A: The process of digestion in vertebrates involves four simple steps: ingestion, digestion,…
Q: Intro to Neuroscience Question Students are celebrating the end of the year and have gotten…
A: The situation displayed includes a reflex activity, which is a quick, automatic reaction to a…
Q: Is there any study that has been done with the herb Bai Zhi (Angelica root) in veterinary medicine?…
A: Bai Zhi (Angelica root) is a traditional Chinese medicine herb that has been used for centuries to…
Q: Search for the required information of this herb in veterinary medicine: - Bai Zhi (Angelica root)…
A: Bai Zhi, also known as Angelica Dahurica or Angelica root, is a plant native to East Asia,…
Q: In what ways are floral traits similar or different between hawkmoth and bat pollination syndromes
A: The transfer of pollen grain from male anther of a flower to the female stigma is known as…
Q: Which are the fittest individuals in a population? Are those that produce the largest number of…
A: One method of evolution is natural selection. More environment-adapted organisms have a higher…
Q: Draw a pair of antiparallel microtubules across the page. The following should be clarified or…
A: Cytoskeleton is a complex of protein filaments and tubules that are associated with providing…
Q: hemoglobin with different properties. Which of the following contributes to the varying 02 binding…
A: Hemoglobin is an iron containing protwun. The iron portion of the hemoglobin is called the heme and…
Q: If a cell with 24 chromosome pairs underwent meiosis, how many total chromatids would be in each…
A: The question particularly focuses on the method of meiosis, a sort of cell division that results in…
Q: Question: Define motor neurons and the properties of each type (upper and lower)
A: Motor neurons are like the messengers of our body's movement system.There are two types: upper motor…
Q: What are questions a research team hopes to answer about the Egyptian mummies and the mummification…
A: Mummification is the process involved in removing the internal organs and moisture from the body and…
Q: Which of the following statements ACCURATELY describe spinal cord organization. α-motor neurons are…
A: The spinal cord is the long bony structure made up of nervous tissue that connects the brain with…
Q: Intro to Neuro Question: Huntington’s disease causes too much ballistic movement due to which of the…
A: Huntington's disease is characterized by the degeneration of neurons in the striatum, particularly…
Q: To describe: The ways by which membrane proteins associate with the lipid bilayer.
A: The main structural components of the plasma membrane are: Phospholipids form lipid bilayer:…
Q: In the glutamate-glutamine cycle, which of the following occurs? Glutamate and GABA are released by…
A: The glutamate-glutamine cycle is a crucial metabolic pathway that occurs in the central nervous…
Q: 11 If 0.1 ml of a 10-3 dilution of a culture is plated out and 65 colonies appear after incubation,…
A: Colony factor unit (CFU) is a unit used to estimate the total count of viable microbes in a given…
Q: Calculate the transpiration rate for the grape leaf above with a leaf surface area of 18 cm2. Air…
A: Transpirtation is the process by which plants lose their water. By this process they remove excess…
Q: A geneticist is using a three-point testcross to map three linked Drosophila recessive mutations…
A: In our analysis of genetic mutations, it is imperative to calculate recombination frequencies to…
Q: 1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a…
A: In the unique ecological setting of the Namib Desert, the interplay between an organism's physical…
Q: Imagine you are a botanist and you recently discovered a new species of plant in the unexplored…
A: This answer discusses the use of fluorescence microscopy techniques to investigate the efficiency of…
Q: This is not a mechanisms for microevolution: Mutation Gene flow Having a small population size that…
A: Evolution can be described as a modification in the inherited characteristics of organisms in a…
Q: Neuroscience: Describe motor cortex maps and the effects of damage to the motor cortex Please…
A: Motor neurons are like the messengers of our body's movement system.There are two types: upper motor…
Q: v a two-state model of a muscle sarcomere - representing relaxed and contracted forms. are your…
A: Muscle fibre consists of A and I bands. These bands are formed due to the regular parallel and…
Q: List two advantages of using sequence analysis of ribosomal components in classification?
A: An essential step in all living things is protein synthesis, which is carried out by cellular…
Q: The diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The…
A: Transcription is a process of formation of the RNA transcript from DNA sequence. Enzyme involved in…
Q: Explain the concepts of specificity and associativity in hippocampal LTP in 2-4 sentences.
A: Synapses are the junctions between neurons where electrical signals are transmitted. They are…
Q: Using the techniques described in this chapter carefully read through the case study and determine…
A: For this situation study, we are given the clinical history of a 73-year-old male patient, Winston…
Q: Describe the type of movement and musculature in the following invertebrates using the table below.…
A: The Animals who don't have backbone are known as invertebrates.. They do not have any bones in their…
Q: What cross will result in half homozygous dominant offspring and half heterozygous offspring? What…
A: Gene is the basic structural unit of heredity. Genes are present in DNA. DNA acts as genetic…
Q: state the biological significance of the results from graph. If the results deviated significantly…
A: Hypotheses are statements of proposed explanations of a phenomenon based on its observation.…
Q: A woman who has blood type A positive has a daughter who is type O positive and a son who is type B…
A: Blood group is the type of antigen present on the surface of blood cells ( Red blood cells) and type…
Q: Order: 1000 mL D5 1/2NS IV to run over 12 hours a) ML/hr b) Macrodrip (15 gtt/mL) c) Microdrip (60…
A: The infusion rate is the rate at which a fluid or medication is administered through an intravenous…
Q: e possible genotypes and phenotypes together that proves the answer.
A: To determine all the possible parental phenotypes for the ABO, MN, and Rh blood group traits, we can…
Q: Bb. na are also ca a. What is the probability that they will have a child affected with CF?…
A: Monohybrid crosses occur when only one characteristic at a time is taken into consideration whereas…
Q: In the graph below, a drug that was inhibitory would cause Membrane potential (mV) +40- 0- -40- -60-…
A: In the graph, you provided, a drug that was inhibitory would cause the membrane potential to be more…
Q: set of true breeding white cows were crossed with true breeding black cows to produce all brown…
A: In this type of cross, if there was complete dominance shown then in the F1 ratio the dominant…
Q: ETC/OP.
A: Electron Transport Chain:It is a critical process in cellular respiration that occurs in…
Q: Here is the question: Question Intro to Neuroscience Question: Students are celebrating the end of…
A: Your answer seems quite coorect.
Q: Which of the following statements about DNA strands is true? (You may choose more than one.) Group…
A: The process of creating an RNA copy of a gene's DNA sequence is known as transcription in the…
Q: This video refers to Denisovans as a “Ghost Lineage.” In fact, Denisovans don’t even have a formal…
A: A type specimen is a single physical specimen that is designated as the representative of a…
Q: What artifacts were present in the grave of Burial Yakovlevka? Describe what they might be and where…
A: The question relates to the artifacts found within the grave of Burial Yakovlevka. Artifacts found…
Q: Intro to Neuro: Which hormone is released by the testes but not by the ovaries? Group of answer…
A: The question is about a very interesting field of science called endocrinology, which studies the…
Q: Question 1: Compare and contrast at least four medical imagining techniques in terms of their…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: In 2-3 paragraphs (must be typed) explain: Discuss the regulation of cholesterol synthesis.
A: Cholesterol synthesis is a complex process that is tightly regulated by a variety of factors,…
Q: Draw a relaxed and contracted sarcomere and label the parts of the Z-discs, thick and thin…
A: The tightening, decreasing, or lengthening of muscles during an activity is known as muscular…
Q: 1. Which of the following is not a biohazard? a used hypodermic syringe moldy bread or cheese…
A: A biohazard refers to a biological substance or agent that poses a threat to the health and safety…
Please answer fast i give upvote
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time (C0t1/2). Plot a graph below that describes how genome sizes of MS2, T4 and E.coli affects the half-reaction time.Which type of DNA cleavage is done in the Maxam Gilbert method?a) Edgeb) Interstitialc) Base-specificd) Gene-specific#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication forkWhich one of the following statements is true? a. Dideoxynucleotides signal the end of DNA replication in a cell b. None of the provided answers are true c. The DNA sequence determined by an autoradiogram should be identical to the template strand DNA sequence d. The probe hybridization solution used in the Sothern blot technique is approximately pH 10.0 e. The transfer buffer used in the Southern blot technique is approximately pH 7.0
- Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicaseAll are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.
- Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymeraseWhich of the enzymes from the following list wouldyou need to make a recombinant DNA molecule? Whatis the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase